or
or
Exact

Results for "AKAP6"

Variant Events: 57

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AKAP6     AU3716302chr14:
32839129-32839129
CTintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     AU4260303chr14:
33129067-33129067
ATintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     A1chr14:
33153642-33153642
TCintronicDe novo--Wu2018 G
AKAP6     2-0063-005chr14:
33336515-33336515
ACintergenicDe novo--Yuen2017 G
AKAP6     2-1646-003chr14:
33399966-33399966
TCintergenicDe novo--Yuen2017 G
AKAP6     7-0024-005chr14:
32684041-32684041
CTintergenicDe novo--Yuen2017 G
AKAP6     2-0057-004chr14:
33217451-33217451
AGintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     1-0871-003chr14:
32957046-32957046
CTintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     2-0197-004chr14:
32916593-32916597
GTTCTGintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     2-0295-003chr14:
32938567-32938567
GAintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     1-0673-003chr14:
32837315-32837315
CTintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     1-0971-003chr14:
33292525-33292525
ATexonicDe novononsynonymous SNVNM_004274c.A5506Tp.M1836L2.866-Trost2022 G
Yuen2017 G
Zhou2022 GE
AKAP6     AU043804chr14:
33153460-33153460
CTintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     1-0290-003chr14:
32821889-32821889
AGintronicDe novo--Yuen2017 G
AKAP6     AU4433301chr14:
32851251-32851251
CTintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     AU4197301chr14:
32799183-32799183
GAintronicDe novo--Yuen2017 G
AKAP6     AU4033305chr14:
32681573-32681573
CGintergenicDe novo--Yuen2017 G
AKAP6     2-1254-003chr14:
33201116-33201116
TCintronicDe novo--Yuen2016 G
AKAP6     2-1374-003chr14:
32841488-32841488
GAintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     AU4033305chr14:
32682240-32682240
TCintergenicDe novo--Yuen2017 G
AKAP6     13023.p1chr14:
33130276-33130276
GAintronicDe novo--Turner2016 G
AKAP6     5-0030-003chr14:
33368358-33368358
TTCCintergenicDe novo--Yuen2017 G
AKAP6     AU3175302chr14:
33069460-33069460
AGintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     2-1725-003chr14:
33397072-33397072
GAintergenicDe novo--Yuen2017 G
AKAP6     13945.p1chr14:
33404059-33404059
GGAintergenicDe novo--Wilfert2021 G
AKAP6     SJD_65.3chr14:
32878873-32878873
AGintronicDe novo--Trost2022 G
AKAP6     13825.p1chr14:
32981815-32981815
AGintronicDe novo--Wilfert2021 G
AKAP6     2-1238-003chr14:
32901172-32901172
CTintronicDe novo--Trost2022 G
AKAP6     MSSNG00351-003chr14:
32805594-32805594
GAintronicDe novo--Trost2022 G
AKAP6     MSSNG00387-003chr14:
32842429-32842429
GAintronicDe novo--Trost2022 G
AKAP6     1-0595-005chr14:
33086217-33086217
CAintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     74-0355chr14:
32758933-32758933
TCintergenicInherited--Michaelson2012 G
AKAP6     14093.p1chr14:
32830259-32830259
CCATATATATATintronicDe novo--Wilfert2021 G
AKAP6     7-0361-003chr14:
33184427-33184427
CTintronicDe novo--Trost2022 G
AKAP6     MSSNG00398-003chr14:
33189488-33189488
CTintronicDe novo--Trost2022 G
AKAP6     A15chr14:
32867315-32867315
CTintronicDe novo--Wu2018 G
AKAP6     MSSNG00023-004chr14:
33147481-33147481
AGintronicDe novo--Trost2022 G
AKAP6     1-0112-004chr14:
33265665-33265665
GAintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     7-0189-003chr14:
33184395-33184395
AGintronicDe novo--Trost2022 G
AKAP6     1-0105-003chr14:
33054019-33054019
AGintronicDe novo--Trost2022 G
AKAP6     1-1156-003chr14:
33065589-33065589
AGintronicDe novo--Trost2022 G
AKAP6     4-0062-003chr14:
32926876-32926876
ATintronicDe novo--Trost2022 G
AKAP6     3-0531-000chr14:
32990344-32990344
CTintronicDe novo--Trost2022 G
AKAP6     MCD-033-3chr14:
33290621-33290621
TCexonicPaternalnonsynonymous SNVNM_004274c.T3602Cp.V1201A16.363.486E-5Tuncay2023 G
AKAP6     AU055603chr14:
33252412-33252412
TCintronicDe novo--Trost2022 G
AKAP6     1-0859-003chr14:
33261714-33261714
CAintronicDe novo--Trost2022 G
AKAP6     MT_99.3chr14:
33237247-33237248
ATAintronicDe novo--Trost2022 G
AKAP6     7-0077-003chr14:
33278363-33278363
AGintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     MT_15.3chr14:
33247370-33247370
CAintronicDe novo--Trost2022 G
AKAP6     2-0503-004chr14:
33030373-33030373
AATintronicDe novo--Yuen2017 G
AKAP6     2-1362-003chr14:
33258115-33258115
CAintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     11685.p1chr14:
33201692-33201692
GAexonicMosaicsynonymous SNVNM_004274c.G3033Ap.L1011L--Krupp2017 E
AKAP6     AU3858302chr14:
32807134-32807134
GAintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     AU3190305chr14:
32934155-32934155
AGintronicDe novo--Trost2022 G
Yuen2017 G
AKAP6     3-0111-000chr14:
33201220-33201220
ATintronicDe novo--Yuen2016 G
AKAP6     MCD-033-3chr14:
33016175-33016175
CAexonicMaternalnonsynonymous SNVNM_004274c.C2316Ap.D772E9.84-Tuncay2023 G
AKAP6     AU2495301chr14:
33269431-33269459
CATATACAAAAATATATATATACAAAAATCATATACAAAAATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More