or
or
Exact

Results for "NOL4"

Variant Events: 57

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NOL4     1-0652-004chr18:
31694620-31694620
TCintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     1-0274-004chr18:
31693392-31693392
CGintronicDe novo--Yuen2017 G
NOL4     AU3586303chr18:
31459294-31459294
TAintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     AU3912302chr18:
31514515-31514515
GAintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     13143.p1chr18:
31703913-31703913
TAintronicDe novo--Wilfert2021 G
NOL4     AU4211304chr18:
31768280-31768280
TCintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     2-1169-003chr18:
31657098-31657098
GAintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     AU076704chr18:
31488851-31488851
TAintronicDe novo--Yuen2017 G
NOL4     14246.p1chr18:
31803227-31803227
GCUTR5De novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
NOL4     74-0688chr18:
31567744-31567744
AGintronicDe novo--Michaelson2012 G
NOL4     63-343chr18:
31791702-31791702
AGintronicDe novo--Michaelson2012 G
NOL4     1-0736-003chr18:
31655155-31655155
TCintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     1-0274-003chr18:
31693392-31693392
CGintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     2-1437-003chr18:
31765859-31765859
CTintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     2-1815-003chr18:
31480299-31480299
TAintronicDe novo--Trost2022 G
NOL4     AU045514chr18:
31482028-31482028
GAintronicDe novo--Yuen2017 G
NOL4     3-0175-000chr18:
31500796-31500796
TCintronicDe novo--Trost2022 G
NOL4     2-1206-003chr18:
31450856-31450856
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NOL4     MSSNG00422-004chr18:
31473157-31473157
CAintronicDe novo--Trost2022 G
NOL4     2-0320-003chr18:
31701644-31701644
TCintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     MSSNG00204-003chr18:
31578366-31578366
AGintronicDe novo--Trost2022 G
NOL4     REACH000569chr18:
31600569-31600569
CAintronicDe novo--Trost2022 G
NOL4     4-0046-003chr18:
31533434-31533434
TAintronicDe novo--Trost2022 G
NOL4     AU2320301chr18:
31535635-31535635
GTintronicDe novo--Trost2022 G
NOL4     2-1547-003chr18:
31518162-31518162
TGintronicDe novo--Trost2022 G
NOL4     5-5027-003chr18:
31527823-31527823
CTintronicDe novo--Trost2022 G
NOL4     MSSNG00406-003chr18:
31502305-31502305
AGintronicDe novo--Trost2022 G
NOL4     2-1322-004chr18:
31533550-31533550
TCintronicDe novo--Yuen2017 G
NOL4     1-0455-004chr18:
31508928-31508931
ATGCTGTAACCAintronicDe novo--Trost2022 G
NOL4     2-1511-003chr18:
31961621-31961636
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
NOL4     REACH000504chr18:
31708866-31708866
TCintronicDe novo--Trost2022 G
NOL4     MT_16.3chr18:
31709805-31709805
AGintronicDe novo--Trost2022 G
NOL4     7-0279-003chr18:
31665936-31665936
TCintronicDe novo--Trost2022 G
NOL4     AU2186301chr18:
31670799-31670799
GAintronicDe novo--Trost2022 G
NOL4     7-0198-003chr18:
31636709-31636709
CCTintronicDe novo--Trost2022 G
NOL4     AU2250301chr18:
31654876-31654876
TGintronicDe novo--Trost2022 G
NOL4     2-1743-003Achr18:
31603546-31603546
AGintronicDe novo--Trost2022 G
NOL4     REACH000767chr18:
31625623-31625623
GTintronicDe novo--Trost2022 G
NOL4     AU059003chr18:
31782158-31782158
AGintronicDe novo--Trost2022 G
NOL4     10-0008-003chr18:
31795994-31795994
CTintronicDe novo--Trost2022 G
NOL4     REACH000724chr18:
31769135-31769135
GAintronicDe novo--Trost2022 G
NOL4     2-0007-004chr18:
31781086-31781088
GACAAGintronicDe novo--Trost2022 G
NOL4     MSSNG00256-004chr18:
31747467-31747467
GAintronicDe novo--Trost2022 G
NOL4     AM02ZF-03chr18:
31758211-31758211
TCintronicDe novo--Trost2022 G
NOL4     3-0086-000chr18:
31720901-31720901
TCintronicDe novo--Trost2022 G
NOL4     A20chr18:
31785561-31785561
CAintronicDe novo--Wu2018 G
NOL4     AU4310301chr18:
31680663-31680663
GTintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     AU2718301chr18:
31722665-31722665
GAintronicDe novo--Trost2022 G
NOL4     AU3905301chr18:
31723775-31723775
GAintronicDe novo--Yuen2017 G
NOL4     2-1391-003chr18:
31686155-31686155
ATintronicDe novo--Trost2022 G
Yuen2017 G
NOL4     SSC11113chr18:
31803227-31803227
GCUTR5De novo--Trost2022 G
NOL4     1-0965-003chr18:
32030587-32030587
GAintergenicDe novo--Yuen2017 G
NOL4     14015.p1chr18:
31983713-31983713
GAintergenicDe novo--Turner2016 G
NOL4     1-0041-003chr18:
31946736-31946736
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
NOL4     1-0338-005chr18:
31993209-31993209
TCintergenicDe novo--Yuen2017 G
NOL4     AU3371302chr18:
32046281-32046281
TCintergenicDe novo--Yuen2017 G
NOL4     5-0061-003chr18:
31569460-31569460
AGintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More