or
or
Exact

Results for "LRMDA"

Variant Events: 131

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRMDA     74-0115chr10:
77830946-77830946
CTintronicDe novo--Michaelson2012 G
LRMDA     7-0068-003chr10:
77825598-77825598
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     2-1391-004chr10:
78504597-78504597
CTintergenicDe novo--Yuen2017 G
LRMDA     2-1355-004chr10:
78491935-78491935
CTintergenicDe novo--Yuen2017 G
LRMDA     AU4093302chr10:
77850934-77850934
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU4159302chr10:
78303961-78303961
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     7-0129-003chr10:
77465748-77465748
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU4283301chr10:
78284742-78284742
CAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU3712302chr10:
78196482-78196482
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU3638302chr10:
78509918-78509918
CTintergenicDe novo--Yuen2017 G
LRMDA     7-0192-003chr10:
78542423-78542423
GTintergenicDe novo--Yuen2017 G
LRMDA     2-1086-003chr10:
78083593-78083593
ACintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     7-0223-003chr10:
78361846-78361846
AGintergenicDe novo--Yuen2017 G
LRMDA     2-1384-003chr10:
77772940-77772940
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU3721301chr10:
77402019-77402019
TGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     MSSNG00127-004chr10:
77208647-77208647
CTintronicDe novo--Trost2022 G
LRMDA     5-0064-003chr10:
77676213-77676213
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU4452302chr10:
77748229-77748229
ATintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     4-0069-003chr10:
77391170-77391170
GCintronicDe novo--Trost2022 G
LRMDA     2-1296-003chr10:
78423831-78423831
TCintergenicDe novo--Yuen2017 G
LRMDA     AU1988301chr10:
77888448-77888448
ATintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     3-0785-000chr10:
77398659-77398659
TCintronicDe novo--Trost2022 G
LRMDA     AU055603chr10:
77274891-77274891
TCintronicDe novo--Trost2022 G
LRMDA     3-0612-000chr10:
77275968-77275968
GTintronicDe novo--Trost2022 G
LRMDA     3-0345-001chr10:
77259677-77259677
AGintronicDe novo--Trost2022 G
LRMDA     2-1757-003chr10:
77265978-77265978
AGintronicDe novo--Trost2022 G
LRMDA     1-0859-003chr10:
77229782-77229782
CTintronicDe novo--Trost2022 G
LRMDA     E3F6Y_01chr10:
77252768-77252768
AGintronicDe novo--Trost2022 G
LRMDA     1-1119-003chr10:
77565989-77565989
AGintronicDe novo--Trost2022 G
LRMDA     2-1733-003chr10:
77603043-77603043
CTintronicDe novo--Trost2022 G
LRMDA     1-0868-003chr10:
77552188-77552188
AGintronicDe novo--Trost2022 G
LRMDA     7-0248-003chr10:
77903523-77903523
CGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     2-1345-003chr10:
78587364-78587364
CTintergenicDe novo--Yuen2017 G
LRMDA     3-0221-000chr10:
77408792-77408793
TGCCintronicDe novo--Trost2022 G
LRMDA     MT_44.3chr10:
77453183-77453183
CGintronicDe novo--Trost2022 G
LRMDA     MSSNG00402-003chr10:
77683301-77683301
CAintronicDe novo--Trost2022 G
LRMDA     1-0912-003chr10:
77693320-77693320
CGintronicDe novo--Trost2022 G
LRMDA     SJD_50.3chr10:
77647587-77647587
AGintronicDe novo--Trost2022 G
LRMDA     1-1000-003Achr10:
77677267-77677267
CTintronicDe novo--Trost2022 G
LRMDA     4-0004-003chr10:
77627994-77627994
GAintronicDe novo--Trost2022 G
LRMDA     1-0644-003chr10:
77630624-77630624
CTintronicDe novo--Trost2022 G
LRMDA     3-0309-000chr10:
77608460-77608460
CTintronicDe novo--Trost2022 G
LRMDA     MSSNG00031-004chr10:
77624160-77624160
CAintronicDe novo--Trost2022 G
LRMDA     1-0382-003chr10:
78120800-78120800
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     MSSNG00033-003chr10:
77757717-77757717
GAintronicDe novo--Trost2022 G
LRMDA     REACH000380chr10:
77768225-77768225
CTintronicDe novo--Trost2022 G
LRMDA     MSSNG00204-003chr10:
77743239-77743239
TCintronicDe novo--Trost2022 G
LRMDA     REACH000173chr10:
77754442-77754442
CTintronicDe novo--Trost2022 G
LRMDA     REACH000559chr10:
77728920-77728920
AGintronicDe novo--Trost2022 G
LRMDA     7-0094-004chr10:
77735095-77735095
CTintronicDe novo--Trost2022 G
LRMDA     2-1501-003chr10:
78453029-78453029
TCintergenicDe novo--Yuen2017 G
LRMDA     MSSNG00201-003chr10:
77701997-77701997
GAintronicDe novo--Trost2022 G
LRMDA     3-0093-000chr10:
77719395-77719396
TATintronicDe novo--Trost2022 G
LRMDA     7-0235-003chr10:
77931144-77931144
GAintronicDe novo--Trost2022 G
LRMDA     2-1688-003chr10:
77947870-77947870
TGintronicDe novo--Trost2022 G
LRMDA     AU2320301chr10:
77891898-77891898
TCintronicDe novo--Trost2022 G
LRMDA     1-1128-003chr10:
77907419-77907419
GAintronicDe novo--Trost2022 G
LRMDA     2-0725-003chr10:
77819319-77819319
AGintronicDe novo--Trost2022 G
LRMDA     AU3727303chr10:
78362136-78362136
AGintergenicDe novo--Yuen2017 G
LRMDA     4-0040-004chr10:
77838831-77838831
TCintronicDe novo--Trost2022 G
LRMDA     1-0455-004chr10:
77895459-77895459
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU3451301chr10:
78342225-78342231
GCCACTTGCCACTTCCACTTintergenicDe novo--Yuen2017 G
LRMDA     4-0035-003chr10:
77781934-77781934
TAintronicDe novo--Trost2022 G
LRMDA     2-0320-003chr10:
77794765-77794765
CTintronicDe novo--Trost2022 G
LRMDA     7-0127-003chr10:
78052825-78052825
GAintronicDe novo--Trost2022 G
LRMDA     MSSNG00081-003chr10:
78079630-78079630
CTintronicDe novo--Trost2022 G
LRMDA     1-0289-003chr10:
77678927-77678927
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU4284301chr10:
78472210-78472210
GAintergenicDe novo--Yuen2017 G
LRMDA     2-0197-004chr10:
78022537-78022537
TCintronicDe novo--Trost2022 G
LRMDA     MSSNG00039-004chr10:
78024234-78024234
TAintronicDe novo--Trost2022 G
LRMDA     AU3918301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
LRMDA     2-1097-003chr10:
78003688-78003689
AGGCintronicDe novo--Trost2022 G
LRMDA     3-0719-001chr10:
78012348-78012348
TCintronicDe novo--Trost2022 G
LRMDA     SJD_71.3chr10:
77971347-77971347
CAintronicDe novo--Trost2022 G
LRMDA     3-0398-000chr10:
77973968-77973971
CGTTCintronicDe novo--Trost2022 G
LRMDA     MSSNG00258-005chr10:
78111060-78111060
CTintronicDe novo--Trost2022 G
LRMDA     1-0380-003chr10:
77554843-77554843
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     3-0783-000chr10:
78121579-78121579
CTintronicDe novo--Trost2022 G
LRMDA     MSSNG00258-003chr10:
78111060-78111060
CTintronicDe novo--Trost2022 G
LRMDA     MSSNG00258-004chr10:
78111060-78111060
CTintronicDe novo--Trost2022 G
LRMDA     2-1143-003chr10:
78107246-78107246
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0567-004chr10:
78095905-78095907
GCTCACintronicDe novo--Trost2022 G
LRMDA     2-1562-004chr10:
78226053-78226057
GACAAGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0567-004chr10:
78095911-78095912
CTTTAintronicDe novo--Trost2022 G
LRMDA     1-0203-003chr10:
77556424-77556424
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-1111-003chr10:
78088851-78088851
TCintronicDe novo--Trost2022 G
LRMDA     1-0567-004chr10:
78095896-78095902
GAAGGACCATTTAAintronicDe novo--Trost2022 G
LRMDA     3-0191-000chr10:
78283069-78283069
GAintronicDe novo--Trost2022 G
LRMDA     7-0250-003Achr10:
78318148-78318148
AGintergenicDe novo--Trost2022 G
LRMDA     1-1129-003chr10:
78230746-78230746
TCintronicDe novo--Trost2022 G
LRMDA     REACH000368chr10:
78247181-78247181
TTAACintronicDe novo--Trost2022 G
LRMDA     MSSNG00136-003chr10:
78140335-78140335
GTintronicDe novo--Trost2022 G
LRMDA     2-1368-003chr10:
78211864-78211864
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRMDA     7-0462-003chr10:
78166410-78166410
GAintronicDe novo--Trost2022 G
LRMDA     1-0303-003chr10:
77334385-77334385
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     2-0198-003chr10:
77436317-77436317
CGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     2-0296-004chr10:
77756779-77756779
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU3911301chr10:
78104666-78104666
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     7-0242-003chr10:
78144678-78144678
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     7-0242-003chr10:
78364020-78364020
AGintergenicDe novo--Yuen2017 G
LRMDA     2-1360-003chr10:
78129573-78129573
ATintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRMDA     7-0250-003chr10:
78318148-78318148
AGintergenicDe novo--Yuen2017 G
LRMDA     AU4176302chr10:
77879092-77879092
GTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU4467302chr10:
77351789-77351789
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     7-0253-004chr10:
77219259-77219259
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0629-003chr10:
77442566-77442566
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-1000-003chr10:
77677267-77677267
CTintronicDe novo--Yuen2017 G
LRMDA     5-0140-003chr10:
77600355-77600355
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     2-1438-003chr10:
77699695-77699695
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
LRMDA     AU2437302chr10:
78477655-78477655
GAintergenicDe novo--Yuen2017 G
LRMDA     AU3809302chr10:
78595771-78595771
TCintergenicDe novo--Yuen2017 G
LRMDA     AU3154301chr10:
78010307-78010307
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     mAGRE4172chr10:
77806919-77806920
CACsplicingMaternalsplicing--Cirnigliaro2023 G
LRMDA     2-1348-003chr10:
77784227-77784227
TCintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU4129303chr10:
77894228-77894228
TAintronicDe novo--Yuen2017 G
LRMDA     AU2139305chr10:
78209687-78209687
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU031003chr10:
77819319-77819319
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0508-003chr10:
78299834-78299834
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU078503chr10:
77544293-77544293
TGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0551-003chr10:
78100176-78100176
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     5-0017-003chr10:
78270274-78270274
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0402-003chr10:
78025362-78025362
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     1-0638-003chr10:
77354033-77354033
CTintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU1848302chr10:
78552442-78552442
TAintergenicDe novo--Yuen2017 G
LRMDA     2-1425-003chr10:
77995989-77995989
GAintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU2100302chr10:
78328112-78328112
TAintergenicDe novo--Yuen2017 G
LRMDA     AU3368303chr10:
77930585-77930585
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     2-0299-005chr10:
77994770-77994770
AGintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     7-0251-003chr10:
78599146-78599146
CTintergenicDe novo--Yuen2017 G
LRMDA     1-0450-003chr10:
77349425-77349425
GCintronicDe novo--Trost2022 G
Yuen2017 G
LRMDA     AU1725306chr10:
77258650-77258650
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More