or
or
Exact

Results for "CCDC102B"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CCDC102B     2-0149-004chr18:
66583435-66583435
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     AU073003chr18:
66578715-66578715
CTintronicDe novo--Yuen2017 G
CCDC102B     AU2569301chr18:
66421351-66421351
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     1-0148-005chr18:
66639684-66639684
TCintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     2-1452-003chr18:
66415893-66415893
GAintronicDe novo--Yuen2017 G
CCDC102B     mAGRE1713chr18:
66564666-66564666
GCsplicingPaternalsplicing12.6-Cirnigliaro2023 G
CCDC102B     mAGRE1710chr18:
66564666-66564666
GCsplicingPaternalsplicing12.6-Cirnigliaro2023 G
CCDC102B     5-0128-003chr18:
66510308-66510308
AGintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     13539.p1chr18:
66692362-66692362
TCintronicDe novo--Turner2016 G
CCDC102B     2-0144-004chr18:
66731815-66731815
TAintergenicDe novo--Yuen2017 G
CCDC102B     2-1169-003chr18:
66416367-66416367
TGintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     1-0906-003chr18:
67013200-67013200
CGintergenicDe novo--Yuen2017 G
CCDC102B     7-0068-003chr18:
66867491-66867491
CTintergenicDe novo--Yuen2017 G
CCDC102B     09C83748chr18:
66542034-66542034
GAintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
CCDC102B     1-0469-005chr18:
66776237-66776237
GAintergenicDe novo--Yuen2017 G
CCDC102B     1-0201-004chr18:
66944832-66944832
TAintergenicDe novo--Yuen2017 G
CCDC102B     60-2027chr18:
66635187-66635187
CGintronicDe novo--Michaelson2012 G
CCDC102B     A17chr18:
66931412-66931412
CAintergenicDe novo--Wu2018 G
CCDC102B     MT_183.3chr18:
66437521-66437521
GCintronicDe novo--Trost2022 G
CCDC102B     2-1174-005Bchr18:
67013989-67013989
TCintergenicDe novo--Yuen2017 G
CCDC102B     2-1075-003chr18:
66457720-66457720
CTintronicDe novo--Trost2022 G
CCDC102B     MSSNG00378-003chr18:
66421823-66421823
CTintronicDe novo--Trost2022 G
CCDC102B     AU2717301chr18:
66428709-66428709
CTintronicDe novo--Trost2022 G
CCDC102B     1-0591-003chr18:
66844309-66844326
TTCTCTCTCTCTCTCTCTTTCTCTCTCTCTCTCTintergenicDe novo--Yuen2017 G
CCDC102B     REACH000446chr18:
66568877-66568877
AGintronicDe novo--Trost2022 G
CCDC102B     7-0058-003chr18:
66573180-66573180
GAintronicDe novo--Trost2022 G
CCDC102B     5-0033-004chr18:
66386920-66386920
CGintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     AU2212301chr18:
66563506-66563506
ACintronicDe novo--Trost2022 G
CCDC102B     MSSNG00043-004Achr18:
66565927-66565927
TAintronicDe novo--Trost2022 G
CCDC102B     iHART1710chr18:
66564666-66564666
GCsplicingPaternalsplicing12.6-Ruzzo2019 G
CCDC102B     1-1180-003chr18:
66531165-66531165
AGintronicDe novo--Trost2022 G
CCDC102B     7-0486-003chr18:
66535369-66535369
ATintronicDe novo--Trost2022 G
CCDC102B     MSSNG00255-005chr18:
66464956-66464956
TAintronicDe novo--Trost2022 G
CCDC102B     iHART1713chr18:
66564666-66564666
GCsplicingPaternalsplicing12.6-Ruzzo2019 G
CCDC102B     1-0885-003chr18:
66471266-66471268
GGGTintronicDe novo--Trost2022 G
CCDC102B     5-0038-003chr18:
66691873-66691873
GAintronicDe novo--Trost2022 G
CCDC102B     7-0100-004chr18:
66547836-66547836
CGintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     7-0287-003chr18:
66657710-66657710
GTintronicDe novo--Trost2022 G
CCDC102B     1-0753-003chr18:
66674171-66674171
GTintronicDe novo--Trost2022 G
CCDC102B     1-0323-004chr18:
66849517-66849517
CTintergenicDe novo--Yuen2017 G
CCDC102B     1-1058-003chr18:
66604427-66604427
CTintronicDe novo--Trost2022 G
CCDC102B     MSSNG00221-003chr18:
66639052-66639052
GCintronicDe novo--Trost2022 G
CCDC102B     1-1070-003chr18:
66596666-66596666
GTintronicDe novo--Trost2022 G
CCDC102B     2-0215-003chr18:
67009077-67009103
ACGTTGTGCACATGTACCCTAAAACTTAintergenicDe novo--Yuen2017 G
CCDC102B     AU066403chr18:
66819304-66819304
CAintergenicDe novo--Yuen2017 G
CCDC102B     3-0029-000chr18:
66597480-66597480
TGintronicDe novo--Trost2022 G
CCDC102B     2-0132-004chr18:
66729916-66729916
TCintergenicDe novo--Yuen2017 G
CCDC102B     2-1129-003chr18:
66419454-66419454
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CCDC102B     AU070007chr18:
66521262-66521262
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     AU3903302chr18:
66804564-66804564
CTintergenicDe novo--Yuen2017 G
CCDC102B     2-1736-003chr18:
66909647-66909648
ACAintergenicDe novo--Yuen2017 G
CCDC102B     AU3637301chr18:
66923991-66923991
CAintergenicDe novo--Yuen2017 G
CCDC102B     AU072904chr18:
66722331-66722332
ATAUTR3De novo--Trost2022 G
Yuen2017 G
CCDC102B     1-0215-006chr18:
66497384-66497384
CGintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     AU053503chr18:
66498684-66498684
CTintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     AU3125301chr18:
66888091-66888091
TCintergenicDe novo--Yuen2017 G
CCDC102B     AU1542301chr18:
66588137-66588137
GAintronicDe novo--Trost2022 G
Yuen2017 G
CCDC102B     AU4435301chr18:
66943994-66943994
ACintergenicDe novo--Yuen2017 G
CCDC102B     SP0079733chr18:
66678298-66678298
GAexonicDe novononsynonymous SNVNM_024781
NM_001093729
c.G1391A
c.G1391A
p.R464Q
p.R464Q
4.692.0E-4Trost2022 G
Zhou2022 GE
CCDC102B     3-0607-000chr18:
66504086-66504086
TCexonicDe novononsynonymous SNVNM_024781
NM_001093729
c.T86C
c.T86C
p.M29T
p.M29T
7.796-Trost2022 G
Zhou2022 GE
CCDC102B     MT_69chr18:
66504176-66504176
CGexonicPaternalnonsynonymous SNVNM_024781
NM_001093729
c.C176G
c.C176G
p.A59G
p.A59G
8.3360.0016Toma2013 E
CCDC102B     5-0146-003chr18:
66714419-66714419
TCintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More