or
or
Exact

Results for "OPCML"

Variant Events: 185

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
OPCML     2-1215-003chr11:
132311063-132311063
TTTTTTTTTTGintronicDe novo--Yuen2017 G
OPCML     AU3900301 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
OPCML     1-0009-004chr11:
132924985-132924985
GAintronicDe novo--Yuen2017 G
OPCML     2-1360-003chr11:
133080281-133080281
GAintronicDe novo--Yuen2017 G
OPCML     7-0068-003chr11:
132504991-132504991
AGintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU4056302chr11:
132897483-132897483
GCintronicDe novo--Yuen2017 G
OPCML     3-0456-000chr11:
133380781-133380817
TACACACACACACACACGCACACACACACACACACACTACACACACACACACGCACACACACACACACACACintronicDe novo--Yuen2017 G
OPCML     AU4032305chr11:
133284030-133284030
GTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0443-003chr11:
133244670-133244670
CAintronicDe novo--Yuen2016 G
OPCML     AU4433301chr11:
132685765-132685765
CAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU028305 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
OPCML     AU4379301chr11:
132635800-132635800
CTintronicDe novo--Yuen2017 G
OPCML     1-0006-004chr11:
133185145-133185145
CCTTintronicDe novo--Yuen2017 G
OPCML     AU2139301chr11:
132303557-132303557
GCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     74-0352chr11:
133255039-133255039
CTintronicDe novo--Michaelson2012 G
OPCML     1-0957-003chr11:
132285328-132285328
TCUTR3De novo--Trost2022 G
OPCML     MSSNG00045-005chr11:
132296471-132296471
CAintronicDe novo--Trost2022 G
OPCML     2-1425-004chr11:
132384406-132384406
GGCintronicDe novo--Yuen2017 G
OPCML     AU005214chr11:
132306284-132306284
AGintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     14-1775chr11:
132285120-132285120
AGUTR3De novo--Trost2022 G
OPCML     2-0122-004chr11:
133009176-133009176
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     SP0026296chr11:
132813009-132813009
ACUTR5De novo-3.0E-4Fu2022 E
OPCML     1-0336-003chr11:
132458466-132458490
CTCCAGCCCCTTCTTTAGGGATGATCintronicDe novo--Trost2022 G
OPCML     4-0062-003chr11:
132458961-132458962
ATTAintronicDe novo--Trost2022 G
OPCML     A3chr11:
132446810-132446810
CTintronicDe novo--Wu2018 G
OPCML     10-1155-004chr11:
132337952-132337952
TCintronicDe novo--Trost2022 G
OPCML     7-0121-003chr11:
132341438-132341438
TGintronicDe novo--Trost2022 G
OPCML     MT_154.3chr11:
132317144-132317144
TCintronicDe novo--Trost2022 G
OPCML     MSSNG00024-003Achr11:
132329588-132329588
CTintronicDe novo--Trost2022 G
OPCML     2-1374-003chr11:
133286812-133286812
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     SJD_55.3chr11:
132297583-132297583
AGintronicDe novo--Trost2022 G
OPCML     MSSNG00250-003chr11:
132302764-132302764
CTintronicDe novo--Trost2022 G
OPCML     5-0001-003chr11:
132530622-132530622
GAintronicDe novo--Trost2022 G
OPCML     2-1694-003chr11:
132533460-132533460
AGintronicDe novo--Trost2022 G
OPCML     1-0291-003chr11:
132508762-132508762
AGintronicDe novo--Trost2022 G
OPCML     5-5123-005chr11:
132529637-132529637
TCintronicDe novo--Trost2022 G
OPCML     AU2283301chr11:
132487990-132487990
TCintronicDe novo--Trost2022 G
OPCML     1-0901-004chr11:
133260227-133260227
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0844-003chr11:
132506445-132506445
AGintronicDe novo--Trost2022 G
OPCML     AU055603chr11:
132459621-132459621
TCintronicDe novo--Trost2022 G
OPCML     5-1004-003Achr11:
132460775-132460775
CTintronicDe novo--Trost2022 G
OPCML     5-5025-004chr11:
132626917-132626917
CTintronicDe novo--Trost2022 G
OPCML     AU3903302chr11:
133441362-133441362
TCintergenicDe novo--Yuen2017 G
OPCML     7-0454-003chr11:
132630715-132630715
TGintronicDe novo--Trost2022 G
OPCML     AU3811305chr11:
132385007-132385007
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     MSSNG00021-004chr11:
132572295-132572295
CTintronicDe novo--Trost2022 G
OPCML     5-5127-003chr11:
132598749-132598749
GAintronicDe novo--Trost2022 G
OPCML     AU050604 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
OPCML     2-1787-003chr11:
132542082-132542082
GAintronicDe novo--Trost2022 G
OPCML     1-0162-004chr11:
132449600-132449600
CTintronicDe novo--Yuen2017 G
OPCML     SJD_34.3 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
OPCML     2-1291-003chr11:
133002649-133002649
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
OPCML     AU026604chr11:
132522947-132522947
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU2320301chr11:
132536265-132536265
AGintronicDe novo--Trost2022 G
OPCML     3-0359-000chr11:
132538783-132538783
CAintronicDe novo--Trost2022 G
OPCML     1-0271-003chr11:
132392557-132392557
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0433-004chr11:
133174445-133174445
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-0197-004chr11:
132663735-132663735
TTAintronicDe novo--Trost2022 G
OPCML     2-1066-004chr11:
132677027-132677027
CAintronicDe novo--Trost2022 G
OPCML     MT_81.3chr11:
132662842-132662842
ATintronicDe novo--Trost2022 G
OPCML     2-0197-004chr11:
132663732-132663732
TCintronicDe novo--Trost2022 G
OPCML     3-0752-000chr11:
132643590-132643590
CAintronicDe novo--Trost2022 G
OPCML     MSSNG00048-003chr11:
132655797-132655797
TAintronicDe novo--Trost2022 G
OPCML     14545.p1chr11:
133318969-133318969
TCintronicDe novo--Werling2018 G
OPCML     MSSNG00445-003chr11:
132641397-132641401
CAATTCintronicDe novo--Trost2022 G
OPCML     AU3729303chr11:
132550660-132550660
TCintronicDe novo--Yuen2017 G
OPCML     MSSNG00112-003chr11:
132641814-132641814
GAintronicDe novo--Trost2022 G
OPCML     1-0664-003Achr11:
132842342-132842342
TAintronicDe novo--Trost2022 G
OPCML     5-5098-003chr11:
132844374-132844374
GAintronicDe novo--Trost2022 G
OPCML     AU3727303chr11:
133529609-133529609
GTintergenicDe novo--Yuen2017 G
OPCML     10-0007-003chr11:
132769898-132769898
GAintronicDe novo--Trost2022 G
OPCML     MSSNG00360-003chr11:
132781332-132781332
CTintronicDe novo--Trost2022 G
OPCML     MT_121.3chr11:
132721132-132721132
TTAintronicDe novo--Trost2022 G
OPCML     1029chr11:
132763155-132763155
TTCAAAAintronicDe novo--Trost2022 G
OPCML     2-0019-004chr11:
132697947-132697947
AAAGintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     REACH000214chr11:
132678540-132678540
CTintronicDe novo--Trost2022 G
OPCML     3-0102-000chr11:
132687317-132687317
AGintronicDe novo--Trost2022 G
OPCML     1-0636-003chr11:
132440428-132440428
GTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU2817301chr11:
132893541-132893541
AGintronicDe novo--Trost2022 G
OPCML     9-0011-003chr11:
132897512-132897512
TTGTAintronicDe novo--Trost2022 G
OPCML     2-0018-004chr11:
132891545-132891550
GGGGATCAGAAGintronicDe novo--Trost2022 G
OPCML     2-0018-004chr11:
132891553-132891553
CAintronicDe novo--Trost2022 G
OPCML     SP0080477chr11:
132875478-132875478
CTintronicDe novo--Trost2022 G
OPCML     REACH000194chr11:
132886546-132886546
GAintronicDe novo--Trost2022 G
OPCML     5-0105-003chr11:
133293647-133293647
GCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     13692.p1chr11:
133246735-133246737
CTTCintronicDe novo--Werling2018 G
OPCML     1-0859-003chr11:
132860471-132860471
AGintronicDe novo--Trost2022 G
OPCML     3-0723-000chr11:
132870288-132870288
GAintronicDe novo--Trost2022 G
OPCML     2-1800-003chr11:
132974326-132974326
GGAintronicDe novo--Trost2022 G
OPCML     2-0149-004chr11:
132897515-132897515
GGTGTGTTGTintronicDe novo--Yuen2017 G
OPCML     5-5098-003chr11:
132983698-132983698
AGintronicDe novo--Trost2022 G
OPCML     REACH000713chr11:
132941658-132941662
AAAACAintronicDe novo--Trost2022 G
OPCML     5-0076-003chr11:
132960910-132960910
GAintronicDe novo--Trost2022 G
OPCML     7-0227-003chr11:
132924594-132924596
TAGTintronicDe novo--Trost2022 G
OPCML     REACH000681chr11:
132932548-132932548
GAintronicDe novo--Trost2022 G
OPCML     9-0011-003chr11:
132897538-132897538
ACGintronicDe novo--Trost2022 G
OPCML     2-1357-004chr11:
132897648-132897653
TTTGACGAGGTGGGGTGGGGintronicDe novo--Trost2022 G
OPCML     1-0191-003chr11:
133040399-133040399
GTCintronicDe novo--Trost2022 G
OPCML     3-0159-000chr11:
133088738-133088738
TCintronicDe novo--Trost2022 G
OPCML     1-0380-003chr11:
132586368-132586368
TCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU2320301chr11:
133029496-133029496
CAintronicDe novo--Trost2022 G
OPCML     1-0935-003chr11:
133059174-133059174
GCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0191-003chr11:
133040395-133040395
AAGintronicDe novo--Trost2022 G
OPCML     AU046506chr11:
133015702-133015702
GAintronicDe novo--Trost2022 G
OPCML     4-0061-003chr11:
133025474-133025474
GAintronicDe novo--Trost2022 G
OPCML     4-0077-003chr11:
133006277-133006277
CCCCACTTTTintronicDe novo--Trost2022 G
OPCML     7-0161-003chr11:
133011331-133011339
TTCCTCAAGTintronicDe novo--Trost2022 G
OPCML     7-0328-003chr11:
133193985-133193985
CTintronicDe novo--Trost2022 G
OPCML     5-5011-003chr11:
133204209-133204210
GAGintronicDe novo--Trost2022 G
OPCML     1-0088-003chr11:
133177059-133177059
GAintronicDe novo--Trost2022 G
OPCML     MSSNG00243-003chr11:
133178565-133178565
AGintronicDe novo--Trost2022 G
OPCML     1-0288-004chr11:
133129443-133129443
CTintronicDe novo--Trost2022 G
OPCML     3-0278-000chr11:
133170707-133170707
GAintronicDe novo--Trost2022 G
OPCML     1-0292-005chr11:
132897385-132897385
TTCintronicDe novo--Yuen2017 G
OPCML     MSSNG00077-004chr11:
133111856-133111856
CCCATintronicDe novo--Trost2022 G
OPCML     2-0503-003chr11:
133203377-133203377
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0217-003chr11:
133121325-133121325
CTintronicDe novo--Trost2022 G
OPCML     REACH000713chr11:
133291620-133291620
CTintronicDe novo--Trost2022 G
OPCML     SP0063208chr11:
133292020-133292020
ACintronicDe novo--Trost2022 G
OPCML     14-613chr11:
133289548-133289548
CTintronicDe novo--Trost2022 G
OPCML     1-0359-003chr11:
133424680-133424680
CAintergenicDe novo--Yuen2017 G
OPCML     SP0005195chr11:
133291498-133291498
AGintronicDe novo--Trost2022 G
OPCML     5-5022-003chr11:
133260782-133260782
CTintronicDe novo--Trost2022 G
OPCML     MSSNG00012-004Achr11:
133264141-133264141
GAintronicDe novo--Trost2022 G
OPCML     5-5162-003chr11:
133205938-133205938
CGintronicDe novo--Trost2022 G
OPCML     MSSNG00421-004chr11:
133228443-133228443
TGintronicDe novo--Trost2022 G
OPCML     AU4092302chr11:
132877242-132877242
CAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     REACH000738 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
OPCML     1-1037-003chr11:
133341679-133341679
GTintronicDe novo--Trost2022 G
OPCML     1-0562-004chr11:
133318599-133318599
GAintronicDe novo--Trost2022 G
OPCML     1-0562-003chr11:
133321566-133321566
TCintronicDe novo--Trost2022 G
OPCML     3-0044-000chr11:
133309385-133309385
TCintronicDe novo--Trost2022 G
OPCML     MSSNG00100-004chr11:
133309580-133309580
TAintronicDe novo--Trost2022 G
OPCML     AU055603chr11:
133295295-133295295
CTintronicDe novo--Trost2022 G
OPCML     1-0604-003chr11:
132707156-132707156
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     5-0055-004chr11:
133121283-133121283
TCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     SP0110464chr11:
133309187-133309187
GGTTintronicDe novo--Trost2022 G
OPCML     1-1003-003Achr11:
133382649-133382651
CTACintronicDe novo--Trost2022 G
OPCML     MSSNG00017-004chr11:
133394005-133394005
GTintronicDe novo--Trost2022 G
OPCML     5-0030-003chr11:
133377361-133377363
GGCATTintronicDe novo--Trost2022 G
OPCML     2-1625-003chr11:
133382418-133382421
CATTCintronicDe novo--Trost2022 G
OPCML     MSSNG00162-003chr11:
133364634-133364634
GCintronicDe novo--Trost2022 G
OPCML     AU066818chr11:
132526565-132526565
GAintronicDe novo--Yuen2017 G
OPCML     7-0351-003chr11:
133375163-133375163
GAintronicDe novo--Trost2022 G
OPCML     5-0058-003chr11:
133346401-133346401
GCintronicDe novo--Trost2022 G
OPCML     3-0393-000chr11:
133360765-133360765
GAintronicDe novo--Trost2022 G
OPCML     1-0567-004chr11:
132569959-132569959
TCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0514-003chr11:
132632612-132632612
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
OPCML     1-0138-004chr11:
133002057-133002057
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU070703chr11:
132347342-132347342
CTintronicDe novo--Yuen2017 G
OPCML     AU3859301chr11:
132312980-132312980
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0007-003chr11:
133450534-133450534
GCintergenicDe novo--Yuen2017 G
OPCML     AU4376301chr11:
133249460-133249460
CGintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-0088-003chr11:
132897517-132897517
TTGTGATGCintronicDe novo--Yuen2017 G
OPCML     1-0169-003chr11:
132897517-132897517
TTGTGATGCintronicDe novo--Yuen2017 G
OPCML     1-0566-003chr11:
132592571-132592571
TCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU3905301chr11:
133087487-133087487
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0357-003chr11:
133236383-133236383
AGintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     7-0058-003chr11:
132677105-132677105
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU2023302chr11:
133539679-133539679
CTintergenicDe novo--Yuen2017 G
OPCML     AU3637301chr11:
132776047-132776047
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-1444-003chr11:
132927464-132927464
ATintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
OPCML     AU3777301chr11:
132354820-132354820
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU031204 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
OPCML     7-0141-003chr11:
132633129-132633129
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0332-003chr11:
133189415-133189415
AATCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-1696-003chr11:
133174729-133174729
TCintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-1402-003chr11:
133607876-133607876
CAintergenicDe novo--Yuen2017 G
OPCML     AU076808chr11:
133538592-133538592
TCintergenicDe novo--Yuen2017 G
OPCML     AU1668302chr11:
133537753-133537766
GGAGTCCACCTTCGGGintergenicDe novo--Yuen2017 G
OPCML     AU2293301chr11:
133509236-133509236
CTintergenicDe novo--Yuen2017 G
OPCML     1-0067-004chr11:
133132122-133132122
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-0503-004chr11:
133203377-133203377
CTintronicDe novo--Yuen2017 G
OPCML     AU009904chr11:
132504763-132504763
ACintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-0122-003chr11:
132897651-132897651
GGGGAATGTAGTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     2-1456-003chr11:
133520060-133520060
GAintergenicDe novo--Yuen2017 G
OPCML     2-1105-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2016 G
Yuen2017 G
OPCML     1-0025-004chr11:
132486776-132486776
GAintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0632-003chr11:
132303327-132303327
CTintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU054303chr11:
132931856-132931856
ACintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     AU3760301chr11:
133506773-133506773
GAintergenicDe novo--Yuen2017 G
OPCML     5-0129-003chr11:
133526201-133526201
GAintergenicDe novo--Yuen2017 G
OPCML     AU4394302chr11:
132554574-132554574
ATintronicDe novo--Trost2022 G
Yuen2017 G
OPCML     1-0201-005chr11:
132448274-132448274
GGCTAintronicDe novo--Yuen2017 G
OPCML     2-1297-004chr11:
133587592-133587592
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More