or
or
Exact

Results for "ATP9B"

Variant Events: 54

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ATP9B     14-1014chr18:
76834044-76834044
GAintronicDe novo--Trost2022 G
ATP9B     MSSNG00022-003chr18:
76872816-76872816
GTintronicDe novo--Trost2022 G
ATP9B     03HI2710Achr18:
76873279-76873279
TGexonicstopgainNM_001306085
NM_198531
c.T483G
c.T483G
p.Y161X
p.Y161X
32.0-Doan2019 E
ATP9B     MSSNG00383-003chr18:
76975725-76975725
TCintronicDe novo--Trost2022 G
ATP9B     AU2328301chr18:
77005859-77005859
GAintronicDe novo--Trost2022 G
ATP9B     7-0011-003chr18:
76967700-76967700
GAintronicDe novo--Trost2022 G
ATP9B     03HI2710Achr18:
76886265-76886265
ATsplicingsplicing22.92.474E-5Doan2019 E
ATP9B     SP0142211chr18:
76969613-76969613
GAintronicDe novo--Trost2022 G
ATP9B     4-0062-003chr18:
76960697-76960697
TGGAACintronicDe novo--Trost2022 G
ATP9B     2-1261-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
ATP9B     MT_167.3chr18:
76903041-76903041
GAintronicDe novo--Trost2022 G
ATP9B     1-1148-003chr18:
76912450-76912450
TCintronicDe novo--Trost2022 G
ATP9B     2-0112-005chr18:
77127131-77127131
CGintronicDe novo--Trost2022 G
ATP9B     SP0111768chr18:
77136155-77136155
GCintronicDe novo--Trost2022 G
ATP9B     SJD_46.3chr18:
77096125-77096125
CTintronicDe novo--Trost2022 G
ATP9B     AU2293301chr18:
77096228-77096228
CTintronicDe novo--Trost2022 G
ATP9B     2-1809-003chr18:
77068707-77068707
GAintronicDe novo--Trost2022 G
ATP9B     MT_188.3chr18:
77069431-77069431
GTintronicDe novo--Trost2022 G
ATP9B     3-0380-000chr18:
77041903-77041903
CAintronicDe novo--Trost2022 G
ATP9B     3-0201-000chr18:
77062272-77062272
CTintronicDe novo--Trost2022 G
ATP9B     PN400313chr18:
77096646-77096646
GCexonicUnknownnonsynonymous SNVNM_001306085
NM_198531
c.G2047C
c.G2047C
p.E683Q
p.E683Q
23.83.0E-4Leblond2019 E
ATP9B     AU3506303chr18:
76964998-76964998
CTintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     2-1722-003chr18:
76965328-76965328
TCintronicDe novo--Yuen2017 G
ATP9B     SP0101923chr18:
77136388-77136389
CACintronicDe novo--Trost2022 G
ATP9B     2-1722-003chr18:
76965346-76965346
CTintronicDe novo--Yuen2017 G
ATP9B     SP0114539chr18:
77136388-77136389
CACintronicDe novo--Trost2022 G
ATP9B     1-0045-004chr18:
76960779-76960779
AAGGTGGAGGTGGGGACTGTCGGGGTCAGintronicDe novo--Yuen2017 G
ATP9B     5-0074-003chr18:
77094582-77094582
GTintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     mAGRE2777chr18:
77104264-77104264
GAsplicingMaternalsplicing12.42-Cirnigliaro2023 G
ATP9B     AU2410302chr18:
77123385-77123385
GCintronicDe novo--Yuen2017 G
ATP9B     mAGRE5149chr18:
76966961-76966961
GTexonicMaternalstopgainNM_001306085
NM_198531
c.G979T
c.G979T
p.E327X
p.E327X
38.0-Cirnigliaro2023 G
ATP9B     mAGRE1647chr18:
76873279-76873279
TGexonicPaternalstopgainNM_001306085
NM_198531
c.T483G
c.T483G
p.Y161X
p.Y161X
32.0-Cirnigliaro2023 G
ATP9B     AU2787301chr18:
76995617-76995617
GAintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     2-1359-003chr18:
77102379-77102379
CTintronicDe novo-0.0022Yuen2017 G
ATP9B     1-0208-003chr18:
77095254-77095254
CTintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     60-2027chr18:
76882806-76882806
AGintronicDe novo--Michaelson2012 G
ATP9B     SP0013092chr18:
77137173-77137173
GTintronicDe novo--Fu2022 E
ATP9B     SP0047212chr18:
77090093-77090142
CTGGAAGAGGAGGTATGTGAGTGACTCTAGCGTGGTTCACAGTGTTTCTACexonicDe novoframeshift deletionNM_001306085
NM_198531
c.2018_2028del
c.2018_2028del
p.L673fs
p.L673fs
--Fu2022 E
ATP9B     7-0256-003chr18:
77106427-77106427
GAintronicDe novo--Yuen2017 G
ATP9B     iHART2777chr18:
77104264-77104264
GAsplicingMaternalsplicing12.42-Ruzzo2019 G
ATP9B     iHART1647chr18:
76873279-76873279
TGexonicPaternalstopgainNM_001306085
NM_198531
c.T483G
c.T483G
p.Y161X
p.Y161X
32.0-Ruzzo2019 G
ATP9B     5-0106-003chr18:
77142201-77142201
AGintergenicDe novo--Yuen2017 G
ATP9B     PN400379chr18:
77037137-77037137
GAexonicUnknownnonsynonymous SNVNM_001306085
NM_198531
c.G1352A
c.G1352A
p.R451Q
p.R451Q
34.02.471E-5Leblond2019 E
ATP9B     1-0233-004chr18:
76960779-76960779
AAGGCGGAGGTGGGAACTGTCGGGGTCAGintronicDe novo--Yuen2017 G
ATP9B     1-0563-004chr18:
76960735-76960735
GGGGTCAGAGCAGAGGTGGAGGTGGGAACTGTCATintronicDe novo--Yuen2017 G
ATP9B     1-0566-003chr18:
76972095-76972095
CAintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     2-0318-004chr18:
76916829-76916829
AAGGCTGCCintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     2-1250-003chr18:
76960779-76960779
AAGGCGGAGGTGGGAACTGTCGGGGTCAGintronicDe novo--Yuen2017 G
ATP9B     2-1620-004chr18:
76960733-76960733
CCAGGGTCAGAGCAGAGGCGGAGGTGGGAACGTTintronicDe novo--Yuen2017 G
ATP9B     2-1505-004chr18:
76960734-76960734
GGGGGTCAGAGCAGAGGCGGAGGTGGGGACTGTCGGGGTCAGAGCAGAGGTGGAGGTGGGAACTGTCAintronicDe novo--Yuen2017 G
ATP9B     2-0289-004chr18:
76960734-76960734
GGGGGTCAGAGCAGAGGCGGAGGTGGGGACTGTCGGGGTCAGAGCAGAGGTGGAGGTGGGAACTGTCAintronicDe novo--Yuen2017 G
ATP9B     AU2000302chr18:
77054408-77054408
CTintronicDe novo--Trost2022 G
Yuen2017 G
ATP9B     2-1334-003chr18:
76873551-76873551
CAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
ATP9B     1-0455-004chr18:
76960733-76960733
CCGGGGTCAGAGCAGAGGCGGAGGTGGGAACGTTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More