or
or
Exact

Results for "CEP112"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CEP112     1-0479-006chr17:
63696256-63696262
CGGATATCintronicDe novo--Trost2022 G
CEP112     1-0479-006chr17:
63696266-63696309
CCTAACTAGGTTCTTACCTCTCTAGCCTTCTTTCTATACACTGTAintronicDe novo--Trost2022 G
CEP112     2-1800-003chr17:
63672982-63672983
CACintronicDe novo--Trost2022 G
CEP112     7-0390-003chr17:
63691327-63691327
CTintronicDe novo--Trost2022 G
CEP112     5-0066-003chr17:
63827739-63827739
ACintronicDe novo--Trost2022 G
CEP112     3-0322-000chr17:
63828076-63828076
AGintronicDe novo--Trost2022 G
CEP112     1-0838-003chr17:
63805702-63805702
CTintronicDe novo--Trost2022 G
CEP112     12834.p1chr17:
64188316-64188316
TAupstreamDe novo--Wilfert2021 G
CEP112     MSSNG00017-004chr17:
63807358-63807358
GAintronicDe novo--Trost2022 G
CEP112     3-0396-000chr17:
63684763-63684763
AGintronicDe novo--Trost2022 G
Yuen2016 G
CEP112     AU2320301chr17:
63749782-63749783
ATAintronicDe novo--Trost2022 G
CEP112     MSSNG00116-003chr17:
63766450-63766450
TGintronicDe novo--Trost2022 G
CEP112     3-0610-000chr17:
63715633-63715633
GAintronicDe novo--Trost2022 G
CEP112     AU3154302chr17:
64045264-64045264
TGintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     1-1144-003chr17:
63737056-63737056
TGintronicDe novo--Trost2022 G
CEP112     14153.p1chr17:
63959870-63959870
GAintronicDe novo--Turner2016 G
CEP112     5-0086-003chr17:
63950676-63950676
GAintronicDe novo--Trost2022 G
CEP112     13171.p1chr17:
64024365-64024365
TCintronicDe novo--Turner2016 G
CEP112     AU1448303chr17:
63977881-63977881
CTintronicDe novo--Trost2022 G
CEP112     REACH000327chr17:
63922932-63922932
GAintronicDe novo--Trost2022 G
CEP112     14642.p1chr17:
63737673-63737673
TCintronicDe novo--Turner2016 G
CEP112     5-0038-003chr17:
63938095-63938095
AGintronicDe novo--Trost2022 G
CEP112     7-0410-003chr17:
63888777-63888777
CTintronicDe novo--Trost2022 G
CEP112     AU3881301chr17:
63662881-63662881
TCintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     AU2089302chr17:
63898181-63898181
GAintronicDe novo--Trost2022 G
CEP112     MSSNG00216-003chr17:
63854409-63854409
TCintronicDe novo--Trost2022 G
CEP112     REACH000559chr17:
63856265-63856265
AGintronicDe novo--Trost2022 G
CEP112     1-0202-003chr17:
64091181-64091181
GAintronicDe novo--Trost2022 G
CEP112     REACH000293chr17:
64091588-64091588
GTintronicDe novo--Trost2022 G
CEP112     4-0092-003chr17:
64079837-64079837
TCintronicDe novo--Trost2022 G
CEP112     MSSNG00361-003chr17:
64085938-64085938
GCintronicDe novo--Trost2022 G
CEP112     1-1024-003chr17:
64052924-64052924
TCintronicDe novo--Trost2022 G
CEP112     63-343chr17:
64154717-64154717
GAintronicInherited--Michaelson2012 G
CEP112     1029chr17:
64069358-64069358
GCintronicDe novo--Trost2022 G
CEP112     1-1105-005chr17:
63980596-63980596
GCintronicDe novo--Trost2022 G
CEP112     1-0057-003chr17:
64004005-64004005
TAintronicDe novo--Trost2022 G
CEP112     MSSNG00102-003chr17:
64184862-64184862
ATintronicDe novo--Trost2022 G
CEP112     3-0078-000chr17:
64186760-64186760
AGintronicDe novo--Trost2022 G
CEP112     MSSNG00100-004chr17:
64134815-64134815
ACintronicDe novo--Trost2022 G
CEP112     MSSNG00102-003chr17:
64177573-64177573
CTintronicDe novo--Trost2022 G
CEP112     5-0061-003chr17:
64092917-64092917
ATintronicDe novo--Trost2022 G
CEP112     1-0395-004chr17:
64176997-64176997
ATintronicDe novo--Yuen2017 G
CEP112     J4K7A_01chr17:
64126916-64126916
CAintronicDe novo--Trost2022 G
CEP112     1-0300-004chr17:
63705523-63705523
GAintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     mAGRE2285chr17:
63848123-63848124
GTGexonicPaternalframeshift deletionNM_001302891
NM_001199165
c.2066delA
c.2192delA
p.H689fs
p.H731fs
--Cirnigliaro2023 G
CEP112     1-0395-003chr17:
64176997-64176997
ATintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     mAGRE4084chr17:
64049927-64049928
TGTexonicPaternalframeshift deletionNM_001302891
NM_001199165
c.1018delC
c.1144delC
p.Q340fs
p.Q382fs
--Cirnigliaro2023 G
CEP112     mAGRE2999chr17:
63848123-63848124
GTGexonicPaternalframeshift deletionNM_001302891
NM_001199165
c.2066delA
c.2192delA
p.H689fs
p.H731fs
--Cirnigliaro2023 G
CEP112     1-0572-003chr17:
63902530-63902549
TATAATAATAATAATAATAATATAATAATAATAATAAintronicDe novo--Yuen2017 G
CEP112     mAGRE2997chr17:
63848123-63848124
GTGexonicPaternalframeshift deletionNM_001302891
NM_001199165
c.2066delA
c.2192delA
p.H689fs
p.H731fs
--Cirnigliaro2023 G
CEP112     1-0010-005chr17:
63966830-63966830
GGTATATCACGTintronicDe novo--Yuen2017 G
CEP112     2-1146-003chr17:
63640965-63640965
TAintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     1-0563-004chr17:
63910979-63910979
CTintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     MCD-032-4chr17:
63898448-63898448
AGexonicPaternalnonsynonymous SNVNM_001302891
NM_001199165
c.T1859C
c.T1985C
p.V620A
p.V662A
10.674.0E-4Tuncay2023 G
CEP112     AU059903chr17:
63768637-63768637
TCintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     1-0534-006chr17:
63966830-63966830
GGTATATCACGTintronicDe novo--Yuen2017 G
CEP112     MCD-032-4chr17:
64173136-64173136
GAexonicMaternalnonsynonymous SNVNM_001199165
NM_001302891
c.C109T
c.C109T
p.R37W
p.R37W
21.71.0E-4Tuncay2023 G
CEP112     AU4315302chr17:
64025733-64025733
ACintronicDe novo--Yuen2017 G
CEP112     1-0405-003chr17:
64055356-64055356
CTintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     1-0482-003chr17:
63926567-63926567
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CEP112     2-1246-003chr17:
63754225-63754225
TAintronicDe novo--Trost2022 G
Yuen2017 G
CEP112     AU4168306chr17:
64097186-64097186
CAintronicDe novo--Trost2022 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More