or
or
Exact

Results for "AGBL1"

Variant Events: 158

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
AGBL1     MSSNG00363-003chr15:
86887571-86887571
GCintronicDe novo--Trost2022 G
AGBL1     MSSNG00363-003chr15:
86895216-86895216
TCintronicDe novo--Trost2022 G
AGBL1     2-1280-003chr15:
86735401-86735413
GCACACACACACAGCACACACACAintronicDe novo--Yuen2017 G
AGBL1     MSSNG00067-003chr15:
86862768-86862768
CGintronicDe novo--Trost2022 G
AGBL1     NDAR_INVGH325XTH_wes1chr15:
86791126-86791126
ATintronicDe novo--Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
AGBL1     MSSNG00363-003chr15:
86876388-86876388
CGintronicDe novo--Trost2022 G
AGBL1     MSSNG00168-003chr15:
86992644-86992644
AGintronicDe novo--Trost2022 G
AGBL1     1-0674-003chr15:
87438854-87438854
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     MSSNG00437-004chr15:
87009235-87009235
CTintronicDe novo--Trost2022 G
AGBL1     7-0446-003chr15:
86955588-86955588
GTintronicDe novo--Trost2022 G
AGBL1     MSSNG00021-003chr15:
86969891-86969891
TCintronicDe novo--Trost2022 G
AGBL1     1-0699-003chr15:
87047083-87047083
GCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     MSSNG00077-005chr15:
86931048-86931048
AGintronicDe novo--Trost2022 G
AGBL1     AU4394302chr15:
88045655-88045655
AGintergenicDe novo--Yuen2017 G
AGBL1     4-0082-003chr15:
86954986-86954986
TCintronicDe novo--Trost2022 G
AGBL1     MSSNG00214-003chr15:
86914116-86914116
AGintronicDe novo--Trost2022 G
AGBL1     7-0342-005chr15:
86925217-86925217
ACintronicDe novo--Trost2022 G
AGBL1     2-1182-003chr15:
87084682-87084682
GAintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     AU2162302chr15:
86795520-86795520
CGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     SJD_58.3chr15:
87175955-87175955
GAintronicDe novo--Trost2022 G
AGBL1     5-5203-003chr15:
87179784-87179784
AGintronicDe novo--Trost2022 G
AGBL1     7-0449-003chr15:
87144742-87144742
TAintronicDe novo--Trost2022 G
AGBL1     AU3777302chr15:
87083587-87083587
GAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     3-0706-000Achr15:
87156928-87156928
GAintronicDe novo--Trost2022 G
AGBL1     AU066104chr15:
87324087-87324087
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     7-0329-003chr15:
87108648-87108648
GTintronicDe novo--Trost2022 G
AGBL1     2-1184-003chr15:
87206324-87206324
CTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     1-1103-003chr15:
87138191-87138191
GCintronicDe novo--Trost2022 G
AGBL1     7-0389-003chr15:
87019359-87019359
GAintronicDe novo--Trost2022 G
AGBL1     AU2140305chr15:
87278972-87278972
TAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU059003chr15:
87077516-87077516
TAintronicDe novo--Trost2022 G
AGBL1     2-0323-004chr15:
87271737-87271738
GCAGintronicDe novo--Trost2022 G
AGBL1     MSSNG00206-003chr15:
87290358-87290358
GAintronicDe novo--Trost2022 G
AGBL1     2-0202-004chr15:
87561232-87561232
AGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     MSSNG00224-003chr15:
87248524-87248529
GAAACAGintronicDe novo--Trost2022 G
AGBL1     REACH000718chr15:
87262925-87262925
AGintronicDe novo--Trost2022 G
AGBL1     MT_107.3chr15:
87209862-87209862
GAintronicDe novo--Trost2022 G
AGBL1     1-1050-003chr15:
87225857-87225857
AGintronicDe novo--Trost2022 G
AGBL1     AM02ZF-03chr15:
87195227-87195227
AGintronicDe novo--Trost2022 G
AGBL1     AM02ZF-03chr15:
87195235-87195235
CTintronicDe novo--Trost2022 G
AGBL1     AU031004chr15:
88088129-88088129
CGintergenicDe novo--Yuen2017 G
AGBL1     AU2192301chr15:
87322795-87322795
TAintronicDe novo--Trost2022 G
AGBL1     mAGRE4839chr15:
86807692-86807692
CCAexonicPaternalframeshift insertionNM_152336c.1153dupAp.S384fs-1.0E-4Cirnigliaro2023 G
AGBL1     3-0360-000chr15:
87334465-87334465
AGintronicDe novo--Trost2022 G
AGBL1     mAGRE4838chr15:
86807692-86807692
CCAexonicPaternalframeshift insertionNM_152336c.1153dupAp.S384fs-1.0E-4Cirnigliaro2023 G
AGBL1     5-5004-003chr15:
87319427-87319427
AGintronicDe novo--Trost2022 G
AGBL1     MSSNG00222-003chr15:
87321126-87321126
TGintronicDe novo--Trost2022 G
AGBL1     1-1233-003chr15:
87316182-87316182
CGintronicDe novo--Trost2022 G
AGBL1     MSSNG00061-003chr15:
87319137-87319137
TCintronicDe novo--Trost2022 G
AGBL1     5-0009-003chr15:
87297243-87297243
ATintronicDe novo--Trost2022 G
AGBL1     2-1242-003chr15:
87293270-87293270
ATintronicDe novo--Yuen2017 G
AGBL1     REACH000640chr15:
87305204-87305204
CTintronicDe novo--Trost2022 G
AGBL1     2-0007-003chr15:
87631571-87631571
CTintergenicDe novo--Yuen2017 G
AGBL1     MT_178.4chr15:
87427015-87427015
TAintronicDe novo--Trost2022 G
AGBL1     REACH000510chr15:
87439163-87439163
AGintronicDe novo--Trost2022 G
AGBL1     1-1036-003chr15:
87391101-87391101
GCintronicDe novo--Trost2022 G
AGBL1     1-0806-003chr15:
87406705-87406705
AGintronicDe novo--Trost2022 G
AGBL1     5-5064-003chr15:
87380020-87380020
GTintronicDe novo--Trost2022 G
AGBL1     MSSNG00421-009chr15:
87383879-87383879
TCintronicDe novo--Trost2022 G
AGBL1     2-1519-003chr15:
87365992-87365992
ATintronicDe novo--Trost2022 G
AGBL1     1-1011-003chr15:
87376538-87376538
CAintronicDe novo--Trost2022 G
AGBL1     mAGRE1334chr15:
86807805-86807805
GAexonicPaternalstopgainNM_152336c.G1265Ap.W422X23.6-Cirnigliaro2023 G
AGBL1     1-0579-003chr15:
87190881-87190881
GAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU072004chr15:
87801668-87801668
CTintergenicDe novo--Yuen2017 G
AGBL1     1-0402-004chr15:
87251463-87251464
AGAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-1535-003chr15:
87511756-87511756
CAintronicDe novo--Trost2022 G
AGBL1     REACH000249chr15:
87561343-87561343
TCintronicDe novo--Trost2022 G
AGBL1     3-0662-000chr15:
87450440-87450440
GAintronicDe novo--Trost2022 G
AGBL1     AU3124304chr15:
87394209-87394209
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     4-0002-003chr15:
87453353-87453353
CTintronicDe novo--Trost2022 G
AGBL1     5-0055-003chr15:
86944880-86944880
GTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     7-0135-003chr15:
87370134-87370134
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0045-003chr15:
86811066-86811066
CGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-0215-003chr15:
86805007-86805007
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU005214chr15:
87161164-87161164
ATintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-1296-003chr15:
87525291-87525291
AGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0867-003chr15:
87066157-87066157
GCexonicDe novononsynonymous SNVNM_152336c.G2534Cp.G845A15.54-Trost2022 G
Zhou2022 GE
AGBL1     2-1296-003chr15:
87340845-87340845
ATintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     REACH000751chr15:
87097687-87097687
GAexonicDe novosynonymous SNVNM_152336c.G2775Ap.V925V--Trost2022 G
Zhou2022 GE
AGBL1     2-1373-003chr15:
86897347-86897347
GTintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     2-1417-003chr15:
86839308-86839308
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0160-004chr15:
87498234-87498234
AGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0965-003chr15:
87657015-87657015
AGintergenicDe novo--Yuen2017 G
AGBL1     AU026604chr15:
87881104-87881104
GTintergenicDe novo--Yuen2017 G
AGBL1     1-0075-003chr15:
86998774-86998774
TCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     5-0131-003chr15:
88051842-88051842
CAintergenicDe novo--Yuen2017 G
AGBL1     2-0289-004chr15:
86971135-86971135
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU038204chr15:
88053275-88053275
CTintergenicDe novo--Yuen2017 G
AGBL1     AU2495302chr15:
87249877-87249877
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0388-003chr15:
86835704-86835704
CAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU4410302chr15:
87948259-87948259
CGintergenicDe novo--Yuen2017 G
AGBL1     2-0007-004chr15:
87592449-87592449
TCintergenicDe novo--Yuen2017 G
AGBL1     1-0556-003chr15:
87830105-87830114
GTCATTCATTGTCATTintergenicDe novo--Yuen2017 G
AGBL1     74-0075chr15:
88062116-88062116
GAintergenicDe novo--Michaelson2012 G
AGBL1     Li2017:18907chr15:
86791030-86791031
AGAexonicUnknownframeshift deletionNM_152336c.518delGp.R173fs--Li2017 T
AGBL1     Li2017:18911chr15:
86807692-86807692
CCAexonicUnknownframeshift insertionNM_152336c.1153dupAp.S384fs-1.0E-4Li2017 T
AGBL1     AU030804chr15:
86944298-86944298
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-1399-003chr15:
88051840-88051840
ACintergenicDe novo--Yuen2017 G
AGBL1     1-0417-003chr15:
87357268-87357268
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
AGBL1     1-0203-003chr15:
86928730-86928730
GCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU4145303chr15:
86784063-86784063
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0203-003chr15:
86923672-86923672
GCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0203-003chr15:
86922492-86922492
TCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     13515.p1chr15:
86753743-86753743
GAintronicDe novo--Turner2016 G
AGBL1     1-0918-003chr15:
87565790-87565790
TCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-1086-004chr15:
87676268-87676268
GAintergenicDe novo--Yuen2017 G
AGBL1     14637.p1chr15:
87710829-87710829
GAintergenicDe novo--Turner2016 G
AGBL1     5-0087-003chr15:
86958441-86958441
TCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0224-004chr15:
88052733-88052733
TAintergenicDe novo--Yuen2017 G
AGBL1     AU054103chr15:
86935365-86935365
TCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU006804chr15:
87667223-87667223
ATintergenicDe novo--Yuen2017 G
AGBL1     1-0567-004chr15:
87985837-87985839
CAGCintergenicDe novo--Yuen2017 G
AGBL1     1-0372-003chr15:
86750732-86750732
GAintronicDe novo--Yuen2016 G
Yuen2017 G
AGBL1     AU079204chr15:
86726222-86726222
GAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU079204chr15:
87773293-87773293
CTintergenicDe novo--Yuen2017 G
AGBL1     Li2017:19690chr15:
86940602-86940602
CAexonicUnknownnonsynonymous SNVNM_152336c.C2242Ap.R748S24.78.764E-6Li2017 T
AGBL1     2-1213-003chr15:
87592721-87592721
CAintergenicDe novo--Yuen2017 G
AGBL1     AU3057301chr15:
87343421-87343421
GCintronicDe novo--Yuen2017 G
AGBL1     1-0668-003chr15:
87004769-87004769
TAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     Li2017:18chr15:
86791030-86791031
AGAexonicUnknownframeshift deletionNM_152336c.518delGp.R173fs--Li2017 T
AGBL1     1-0448-003chr15:
87098737-87098737
GAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     5-0033-004chr15:
88067606-88067606
TCintergenicDe novo--Yuen2017 G
AGBL1     Li2017:24chr15:
86807692-86807692
CCAexonicUnknownframeshift insertionNM_152336c.1153dupAp.S384fs-1.0E-4Li2017 T
AGBL1     1-0323-004chr15:
87946691-87946691
CTintergenicDe novo--Yuen2017 G
AGBL1     AU3790301chr15:
87392585-87392585
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU4273304chr15:
87322090-87322090
GAintronicDe novo--Yuen2017 G
AGBL1     AU027506chr15:
87878190-87878190
CAintergenicDe novo--Yuen2017 G
AGBL1     AU4032307chr15:
87065723-87065723
AGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU4327303chr15:
86821546-86821546
AGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     3-0431-000chr15:
87259830-87259830
GTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
AGBL1     2-1094-005chr15:
88106759-88106759
ACintergenicDe novo--Yuen2017 G
AGBL1     2-1094-005chr15:
86878098-86878098
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0408-003chr15:
87332013-87332013
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-0585-003chr15:
87123863-87123863
TCintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     AU3808304chr15:
87108233-87108233
CGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-1180-003chr15:
86744794-86744794
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
AGBL1     1-0558-003chr15:
86918033-86918033
CAintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     MSSNG00108-004chr15:
86732466-86732466
AGintronicDe novo--Trost2022 G
AGBL1     AU1668302chr15:
87309554-87309554
CTintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     1-1047-003chr15:
86733566-86733570
TACTATintronicDe novo--Trost2022 G
AGBL1     AU1668302chr15:
87793558-87793558
GAintergenicDe novo--Yuen2017 G
AGBL1     1-0672-003chr15:
86723921-86723921
ACintronicDe novo--Trost2022 G
AGBL1     3-0607-001chr15:
86730928-86730928
CTintronicDe novo--Trost2022 G
AGBL1     AU007503chr15:
88062116-88062116
GAintergenicDe novo--Yuen2017 G
AGBL1     2-1427-003chr15:
87511667-87511667
TAintronicDe novo--Yuen2017 G
AGBL1     2-1275-003chr15:
86831180-86831180
CTCTTTATTTATTTintronicDe novo--Trost2022 G
AGBL1     MSSNG00363-003chr15:
86835658-86835658
CGintronicDe novo--Trost2022 G
AGBL1     SP0041715chr15:
86687006-86687006
GAexonicDe novosynonymous SNVNM_152336c.G54Ap.A18A--Fu2022 E
Trost2022 G
Zhou2022 GE
AGBL1     7-0240-004chr15:
86821280-86821280
AGintronicDe novo--Trost2022 G
AGBL1     1025chr15:
86824765-86824765
TCintronicDe novo--Trost2022 G
AGBL1     A27chr15:
86807700-86807700
AAAexonicDe novoframeshift insertionNM_152336c.1160dupAp.N387fs--Wu2018 G
AGBL1     AU4168306chr15:
87438177-87438177
AGintronicDe novo--Trost2022 G
Yuen2017 G
AGBL1     2-1433-003chr15:
86770282-86770282
GAintronicDe novo--Trost2022 G
AGBL1     A15chr15:
86791031-86791032
GGGexonicDe novoframeshift deletionNM_152336c.519delGp.R173fs--Wu2018 G
AGBL1     AU4463303chr15:
87843300-87843300
CTintergenicDe novo--Yuen2017 G
AGBL1     SP0218302chr15:
86807826-86807826
GTexonicDe novononsynonymous SNVNM_152336c.G1286Tp.C429F11.4-Trost2022 G
AGBL1     3-0176-000chr15:
86754801-86754801
CTintronicDe novo--Trost2022 G
AGBL1     1-0958-003chr15:
86762434-86762435
ACAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More