or
or
Exact

Results for "PIBF1"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PIBF1     2-0158-003chr13:
73516004-73516004
ACintronicDe novo--Trost2022 G
Yuen2017 G
PIBF1     SP0253838chr13:
73468038-73468038
ATexonicDe novononsynonymous SNVNM_006346c.A1439Tp.N480I16.21-Trost2022 G
PIBF1     4-0039-003chr13:
73481665-73481665
TCintronicDe novo--Trost2022 G
PIBF1     3-0208-000chr13:
73449793-73449796
CATTCintronicDe novo--Trost2022 G
PIBF1     MSSNG00421-003chr13:
73464489-73464489
ACintronicDe novo--Trost2022 G
PIBF1     3-0436-000chr13:
73363644-73363644
CTintronicDe novo--Trost2022 G
Yuen2017 G
PIBF1     1-0455-003chr13:
73361953-73361953
CTGTGintronicDe novo--Trost2022 G
PIBF1     MSSNG00400-003chr13:
73366525-73366525
TGintronicDe novo--Trost2022 G
PIBF1     7-0371-004chr13:
73573775-73573775
TCintronicDe novo--Trost2022 G
PIBF1     AU3638302chr13:
73516958-73516958
ATintronicDe novo--Trost2022 G
PIBF1     REACH000681chr13:
73536367-73536369
CAACintronicDe novo--Trost2022 G
PIBF1     74-0352chr13:
73429508-73429508
GCintronicDe novo--Michaelson2012 G
PIBF1     mAGRE4099chr13:
73396121-73396121
GAsplicingMaternalsplicing23.3-Cirnigliaro2023 G
PIBF1     mAGRE2033chr13:
73369495-73369495
AGsplicingPaternalsplicing21.28.742E-6Cirnigliaro2023 G
PIBF1     2-0264-004chr13:
73468769-73468769
AGintronicDe novo--Trost2022 G
Yuen2017 G
PIBF1     mAGRE3018chr13:
73573102-73573103
ACAexonicPaternalframeshift deletionNM_006346c.2193delCp.D731fs--Cirnigliaro2023 G
PIBF1     mAGRE2158chr13:
73572980-73573005
GATTCTCGTTAAGATGCATAGTAAACGexonicPaternalframeshift deletionNM_006346c.2071_2095delp.I691fs--Cirnigliaro2023 G
PIBF1     1-0547-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
PIBF1     5-0017-004chr13:
73438839-73438839
AGintronicDe novo--Trost2022 G
Yuen2017 G
PIBF1     iHART3018chr13:
73573102-73573103
ACAexonicPaternalframeshift deletionNM_006346c.2193delCp.D731fs--Ruzzo2019 G
PIBF1     iHART2158chr13:
73572980-73573005
GATTCTCGTTAAGATGCATAGTAAACGexonicPaternalframeshift deletionNM_006346c.2071_2095delp.I691fs--Ruzzo2019 G
PIBF1     iHART2033chr13:
73369495-73369495
AGsplicingPaternalsplicing21.28.742E-6Ruzzo2019 G
PIBF1     SP0088169chr13:
73482898-73482898
AGintronicDe novo--Fu2022 E
PIBF1     7-0032-003chr13:
73387977-73387977
CTintronicDe novo--Yuen2017 G
PIBF1     1-0025-004chr13:
73572932-73572932
AGintronicDe novo-9.33E-6Trost2022 G
Yuen2017 G
PIBF1     3-0111-000chr13:
73403504-73403504
TGintronicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More