
Results for "MIR4527"

Variant Events: 30

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
MIR4527     1-0006-003chr18:
AATGAintergenicDe novo--Yuen2017 G
MIR4527     1-0006-004chr18:
AATGAintergenicDe novo--Yuen2017 G
MIR4527     AU045514chr18:
GCintergenicDe novo--Yuen2017 G
MIR4527     13298.p1chr18:
CTintergenicDe novo--Turner2016 G
MIR4527     14642.p1chr18:
GAintergenicDe novo--Turner2016 G
MIR4527     AU1687302chr18:
GAintergenicDe novo--Yuen2017 G
MIR4527     2-1356-003chr18:
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4527     AU4129303chr18:
TAintergenicDe novo--Yuen2017 G
MIR4527     1-0373-003chr18:
GAintergenicDe novo--Yuen2017 G
MIR4527     1-0554-003chr18:
GAintergenicDe novo--Trost2022 G
Yuen2017 G
MIR4527     2-1417-003chr18:
AAATintergenicDe novo--Yuen2017 G
MIR4527     AU055004chr18:
GAintergenicDe novo--Yuen2017 G
MIR4527     2-0242-003chr18:
TCintergenicDe novo--Yuen2017 G
MIR4527     1-0186-004chr18:
GTintergenicDe novo--Yuen2017 G
MIR4527     MSSNG00040-004chr18:
ACintergenicDe novo--Trost2022 G
MIR4527     7-0080-003chr18:
GCGintergenicDe novo--Yuen2017 G
MIR4527     AU1687303chr18:
GAintergenicDe novo--Yuen2017 G
MIR4527     5-0051-003chr18:
TCintergenicDe novo--Trost2022 G
MIR4527     1-1086-003chr18:
GCintergenicDe novo--Trost2022 G
MIR4527     1-0526-003chr18:
CCCATGACCACCACCATCATCATintergenicDe novo--Yuen2017 G
MIR4527     AU2000302chr18:
CGintergenicDe novo--Yuen2017 G
MIR4527     AU3839302chr18:
GAintergenicDe novo--Yuen2017 G
MIR4527     2-1702-003chr18:
CTintergenicDe novo--Yuen2017 G
MIR4527     1-0323-003chr18:
AATintergenicDe novo--Yuen2017 G
MIR4527     A10chr18:
CGintergenicDe novo--Wu2018 G
MIR4527     1-0651-003chr18:
CAintergenicDe novo--Yuen2017 G
MIR4527     2-1264-003chr18:
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
MIR4527     63-449chr18:
CTintergenicDe novo--Michaelson2012 G
MIR4527     1-0651-003chr18:
CAintergenicDe novo--Yuen2017 G
MIR4527     AU3808304chr18:
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView