
Results for "PLEKHM1"

Variant Events: 16

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
PLEKHM1     AU4060306chr17:
CTexonicDe novononsynonymous SNVNM_014798c.G1834Ap.E612K25.01.679E-5Trost2022 G
Yuen2017 G
Zhou2022 GE
PLEKHM1     AU3760301chr17:
TCintronicDe novo--Yuen2017 G
PLEKHM1     NP010chr17:
TCexonicDe novononsynonymous SNVNM_014798c.A1390Gp.I464V0.0098.306E-6Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PLEKHM1     SP0010944chr17:
CTexonicDe novononsynonymous SNVNM_014798c.G1862Ap.R621Q10.835.041E-5Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
PLEKHM1     SP0071579chr17:
CTexonicDe novononsynonymous SNVNM_014798c.G1624Ap.E542K22.0-Fu2022 E
Trost2022 G
Zhou2022 GE
PLEKHM1     12921.p1chr17:
CCAAGTAGGAATCCTTCAintronicDe novo--Satterstrom2020 E
PLEKHM1     13907.p1chr17:
GAGGAATCCTTCATACACCCCGTCTGCGATCTGCGGAGGGCAAGTGexonicframeshift deletionNM_014798c.2902_2930delp.I968fs--Zhou2022 GE
PLEKHM1     JASD_Fam0136chr17:
TCexonicDe novononsynonymous SNVNM_014798c.A1390Gp.I464V0.0098.306E-6Takata2018 E
PLEKHM1     SP0218653chr17:
CTexonicDe novononsynonymous SNVNM_014798c.G368Ap.R123Q17.95-Trost2022 G
PLEKHM1     2-1360-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Trost2022 G
Yuen2017 G
Yuen2017 G
PLEKHM1     2-1764-004chr17:
CTintronicDe novo--Trost2022 G
PLEKHM1     MSSNG00349-004chr17:
ACintronicDe novo--Trost2022 G
PLEKHM1     AU2764301chr17:
GCGintronicDe novo--Trost2022 G
PLEKHM1     SSC06080chr17:
CCAAGTAGGAATCCTTCAintronicDe novo--Trost2022 G
PLEKHM1     REACH000721chr17:
GAintronicDe novo--Trost2022 G
PLEKHM1     7-0292-004Achr17:
ATdownstreamDe novo--Trost2022 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView