or
or
Exact

Results for "THSD7B"

Variant Events: 109

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
THSD7B     AU3636301chr2:
138436631-138436643
TACTAACTAACTATACTAACTAintergenicDe novo--Yuen2017 G
THSD7B     1-0493-003chr2:
137699985-137699985
CTintronicDe novo--Yuen2017 G
THSD7B     1-0325-003chr2:
138086442-138086442
CAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU2569303chr2:
137681118-137681118
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU2569303chr2:
137891750-137891750
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0530-003chr2:
137730100-137730101
ATAintronicDe novo--Yuen2016 G
THSD7B     12498.p1chr2:
138198997-138198997
TGintronicDe novo--Turner2016 G
THSD7B     AU039305chr2:
138234161-138234161
TCintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     A19chr2:
138565927-138565927
TCintergenicDe novo--Wu2018 G
THSD7B     1587021chr2:
138413259-138413259
TGintronicDe novo-9.903E-6Satterstrom2020 E
Trost2022 G
THSD7B     1-0494-003chr2:
137706828-137706828
AGintronicDe novo--Yuen2017 G
THSD7B     2-1381-003chr2:
138476835-138476835
TCintergenicDe novo--Yuen2017 G
THSD7B     2-1244-003chr2:
137534430-137534444
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
THSD7B     1-0494-003chr2:
138188229-138188229
GAintronicDe novo--Yuen2017 G
THSD7B     1-0565-004chr2:
138505937-138505937
AGintergenicDe novo--Yuen2017 G
THSD7B     2-0289-004chr2:
138226273-138226273
TCintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU3866301chr2:
138497237-138497237
GAintergenicDe novo--Yuen2017 G
THSD7B     AU4231301chr2:
138224490-138224490
ACintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0403-003chr2:
137890963-137890963
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     2-1735-003chr2:
137710207-137710207
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU009805chr2:
138382251-138382251
TAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0022-004chr2:
138050791-138050791
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     2-1342-003chr2:
137523536-137523536
GAintronicDe novo--Yuen2016 G
THSD7B     AU055004chr2:
138015512-138015512
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0330-004chr2:
137755735-137755735
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     2-1275-003chr2:
138077918-138077918
CAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU4027306chr2:
138634737-138634737
CTintergenicDe novo--Yuen2017 G
THSD7B     AU2410302chr2:
137990486-137990486
CTexonicDe novononsynonymous SNVNM_001316349c.C1933Tp.P645S0.384-Trost2022 G
Yuen2017 G
Zhou2022 GE
THSD7B     SP0077788chr2:
138000068-138000068
TGexonicDe novononsynonymous SNVNM_001316349c.T2192Gp.F731C11.79-Fu2022 E
Trost2022 G
Zhou2022 GE
THSD7B     1-0508-003chr2:
138174627-138174627
TCintronicDe novo--Yuen2017 G
THSD7B     AU066403chr2:
138047742-138047742
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU1542303chr2:
138096442-138096442
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     JASD_Fam0244chr2:
138375981-138375981
GAexonicDe novosynonymous SNVNM_001316349c.G3585Ap.L1195L--Takata2018 E
THSD7B     1-0494-003Achr2:
138188229-138188229
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU4069301chr2:
138194211-138194211
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0494-003Achr2:
137706828-137706828
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0936-003chr2:
138460276-138460276
CAintergenicDe novo--Yuen2017 G
THSD7B     1-0210-004chr2:
138174583-138174583
TGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     7-0222-003chr2:
137835733-137835733
CGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0022-003chr2:
138050791-138050791
CTintronicDe novo--Yuen2016 G
THSD7B     2-1094-005chr2:
137560486-137560486
CTintronicDe novo--Yuen2017 G
THSD7B     1-0459-003chr2:
138127636-138127636
CTintronicDe novo--Yuen2017 G
THSD7B     1-0206-005chr2:
137838062-137838062
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0656-003chr2:
138227858-138227858
CGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     3-0391-000chr2:
138479410-138479410
ACintergenicDe novo--Yuen2017 G
THSD7B     2-1731-003chr2:
138382490-138382490
TCintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     1-0570-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
THSD7B     2-1246-003chr2:
138443472-138443474
GTCGintergenicDe novo--Yuen2017 G
THSD7B     AU4153301chr2:
138361715-138361715
CAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     AU3124302chr2:
138604746-138604746
TCintergenicDe novo--Yuen2017 G
THSD7B     AU2089301chr2:
138317680-138317680
GCintronicDe novo--Yuen2017 G
THSD7B     AU3124302chr2:
138590331-138590331
TGintergenicDe novo--Yuen2017 G
THSD7B     AU3839303chr2:
138611541-138611541
CGintergenicDe novo--Yuen2017 G
THSD7B     MSSNG00427-003chr2:
137568240-137568240
TCintronicDe novo--Trost2022 G
THSD7B     4-0004-003chr2:
137592783-137592783
ATintronicDe novo--Trost2022 G
THSD7B     AU073006chr2:
137532361-137532361
AGintronicDe novo--Trost2022 G
THSD7B     AU4191302chr2:
138070140-138070140
GCintronicDe novo--Yuen2017 G
THSD7B     2-1823-004chr2:
137557676-137557676
TCintronicDe novo--Trost2022 G
THSD7B     AU073003chr2:
137532361-137532361
AGintronicDe novo--Trost2022 G
THSD7B     AU073005chr2:
137532361-137532361
AGintronicDe novo--Trost2022 G
THSD7B     MT_189.3chr2:
137524253-137524253
AGintronicDe novo--Trost2022 G
THSD7B     4-0009-003chr2:
137744216-137744216
AGintronicDe novo--Trost2022 G
THSD7B     MSSNG00335-003chr2:
137766853-137766853
CAintronicDe novo--Trost2022 G
THSD7B     3-0708-000chr2:
137721255-137721255
CTintronicDe novo--Trost2022 G
THSD7B     2-1215-003chr2:
137909782-137909782
CTintronicDe novo--Yuen2017 G
THSD7B     1-0611-005chr2:
137740189-137740189
ATintronicDe novo--Trost2022 G
THSD7B     AU3912302chr2:
137656134-137656134
TCintronicDe novo--Trost2022 G
THSD7B     MSSNG00436-003chr2:
137717747-137717747
GCintronicDe novo--Trost2022 G
THSD7B     MSSNG00044-003chr2:
137595624-137595624
GAintronicDe novo--Trost2022 G
THSD7B     AU059003chr2:
137635408-137635408
ATintronicDe novo--Trost2022 G
THSD7B     REACH000525chr2:
137892011-137892011
CGintronicDe novo--Trost2022 G
THSD7B     2-0014-003chr2:
137895047-137895047
TCintronicDe novo--Trost2022 G
THSD7B     5-5005-003chr2:
137862950-137862950
AGintronicDe novo--Trost2022 G
THSD7B     MSSNG00204-003chr2:
137882159-137882159
TCintronicDe novo--Trost2022 G
THSD7B     MSSNG00082-003chr2:
137821319-137821319
GAintronicDe novo--Trost2022 G
THSD7B     1-0006-004chr2:
138203917-138203917
CTintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     MSSNG00227-003chr2:
137822601-137822601
TCintronicDe novo--Trost2022 G
THSD7B     MT_63.3chr2:
137772978-137772978
GAintronicDe novo--Trost2022 G
THSD7B     3-0654-000chr2:
137820024-137820024
TCintronicDe novo--Trost2022 G
THSD7B     AU006804chr2:
138061270-138061270
ATintronicDe novo--Trost2022 G
THSD7B     MSSNG00345-003chr2:
138088060-138088060
ATintronicDe novo--Trost2022 G
THSD7B     4-0094-003chr2:
138016235-138016236
CTCintronicDe novo--Trost2022 G
THSD7B     4-0062-003chr2:
138030179-138030181
TACATAexonicDe novononframeshift substitutionNM_001316349c.2343_2345ATAN/A--Trost2022 G
THSD7B     2-0149-003chr2:
137803101-137803101
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     3-0548-000chr2:
137960744-137960744
GTintronicDe novo--Trost2022 G
THSD7B     7-0458-003chr2:
137998494-137998494
ATintronicDe novo--Trost2022 G
THSD7B     MSSNG00216-003chr2:
137957326-137957326
GAintronicDe novo--Trost2022 G
THSD7B     AU1933302chr2:
138267550-138267550
TCintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     2-1528-003chr2:
137958559-137958559
AGintronicDe novo--Trost2022 G
THSD7B     MSSNG00419-003chr2:
138270775-138270775
TCintronicDe novo--Trost2022 G
THSD7B     2-1702-003chr2:
137762826-137762826
AGintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     REACH000609chr2:
138339354-138339354
ATintronicDe novo--Trost2022 G
THSD7B     7-0327-003chr2:
138220241-138220241
AGintronicDe novo--Trost2022 G
THSD7B     4-0064-003chr2:
138259799-138259803
AGTAATTTTTTTintronicDe novo--Trost2022 G
THSD7B     4-0056-003chr2:
138180108-138180108
CAintronicDe novo--Trost2022 G
THSD7B     2-1097-003chr2:
138214359-138214360
GACCintronicDe novo--Trost2022 G
THSD7B     MSSNG00066-004chr2:
138093879-138093879
AGintronicDe novo--Trost2022 G
THSD7B     3-0017-000chr2:
138121442-138121442
CAintronicDe novo--Trost2022 G
THSD7B     AU3051303chr2:
138428529-138428529
CTintronicDe novo--Trost2022 G
THSD7B     MSSNG00365-003chr2:
138393028-138393028
GCintronicDe novo--Trost2022 G
THSD7B     SP0140738chr2:
138414735-138414735
TGintronicDe novo--Trost2022 G
THSD7B     3-0475-000chr2:
138342719-138342719
ATintronicDe novo--Trost2022 G
THSD7B     iHART2290chr2:
138421145-138421145
GGGTGAexonicMaternalframeshift insertionNM_001316349c.4651_4652insGTGAp.D1551fs--Ruzzo2019 G
THSD7B     1-1120-003chr2:
138371108-138371108
CTintronicDe novo--Trost2022 G
THSD7B     AU024607chr2:
138352125-138352125
GAintronicDe novo--Trost2022 G
Yuen2017 G
THSD7B     mAGRE2290chr2:
138421145-138421145
GGGTGAexonicMaternalframeshift insertionNM_001316349c.4651_4652insGTGAp.D1551fs--Cirnigliaro2023 G
THSD7B     mAGRE6043chr2:
138400075-138400075
CTexonicMaternalstopgainNM_001316349c.C3817Tp.R1273X45.0-Cirnigliaro2023 G
THSD7B     mAGRE6042chr2:
138400075-138400075
CTexonicMaternalstopgainNM_001316349c.C3817Tp.R1273X45.0-Cirnigliaro2023 G
THSD7B     mAGRE5042chr2:
137988806-137988806
GAsplicingMaternalsplicing28.41.384E-5Cirnigliaro2023 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More