or
or
Exact

Results for "NPHP4"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NPHP4     2-1228-003chr1:
5961303-5961303
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NPHP4     1-0139-003chr1:
5927920-5927920
CTexonicDe novononsynonymous SNVNM_001291594
NM_001291593
NM_015102
c.G1816A
c.G1813A
c.G3352A
p.V606M
p.V605M
p.V1118M
21.54.992E-5Yuen2017 G
Zhou2022 GE
NPHP4     mAGRE4876chr1:
5987793-5987793
CAexonicPaternalstopgainNM_015102c.G1357Tp.E453X38.0-Cirnigliaro2023 G
NPHP4     AU3154302chr1:
5969253-5969253
GAexonicPaternalstopgainNM_015102c.C1462Tp.R488X37.01.0E-4Cirnigliaro2023 G
NPHP4     AU3154301chr1:
5969253-5969253
GAexonicPaternalstopgainNM_015102c.C1462Tp.R488X37.01.0E-4Cirnigliaro2023 G
NPHP4     1-0520-003chr1:
6028050-6028050
GAintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NPHP4     08C72794chr1:
6012771-6012771
GAexonicDe novononsynonymous SNVNM_015102c.C799Tp.H267Y0.223-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
NPHP4     mAGRE4786chr1:
5967174-5967174
CTsplicingPaternalsplicing9.936-Cirnigliaro2023 G
NPHP4     2-0126-004chr1:
5963087-5963087
GCintronicDe novo--Trost2022 G
Yuen2017 G
NPHP4     AU038203chr1:
6006922-6006922
CTintronicDe novo--Trost2022 G
Yuen2017 G
NPHP4     4-0023-003chr1:
5937203-5937203
GAexonicDe novononsynonymous SNVNM_001291594
NM_001291593
NM_015102
c.C1231T
c.C1228T
c.C2767T
p.R411C
p.R410C
p.R923C
15.915.166E-5Trost2022 G
Zhou2022 GE
NPHP4     1-0867-003chr1:
5932128-5932128
CTintronicDe novo--Trost2022 G
NPHP4     AU241Achr1:
5927204-5927204
CTintronicDe novo--Kosmicki2017 E
NPHP4     13768.p1chr1:
6012780-6012780
CTexonicnonsynonymous SNVNM_015102c.G790Ap.V264I1.884.86E-5Zhou2022 GE
NPHP4     MSSNG00046-003chr1:
5937988-5937988
GTintronicDe novo--Trost2022 G
NPHP4     5-5170-003chr1:
5947412-5947412
GAexonicDe novononsynonymous SNVNM_001291594
NM_001291593
NM_015102
c.C883T
c.C880T
c.C2419T
p.R295C
p.R294C
p.R807C
10.348.416E-6Trost2022 G
Zhou2022 GE
NPHP4     SP0190680chr1:
5937260-5937260
CTexonicDe novononsynonymous SNVNM_001291594
NM_001291593
NM_015102
c.G1174A
c.G1171A
c.G2710A
p.V392I
p.V391I
p.V904I
3.457-Trost2022 G
NPHP4     AU006804 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
NPHP4     REACH000219chr1:
6018945-6018945
GAintronicDe novo--Trost2022 G
NPHP4     5-0005-003chr1:
5994685-5994685
GAintronicDe novo--Trost2022 G
NPHP4     MSSNG00023-003chr1:
6019101-6019101
GAintronicDe novo--Trost2022 G
NPHP4     MSSNG00342-004chr1:
5967091-5967091
AGintronicDe novo--Trost2022 G
NPHP4     7-0232-003chr1:
5950121-5950121
GAintronicDe novo--Trost2022 G
NPHP4     1-1155-003chr1:
5987420-5987420
TGintronicDe novo--Trost2022 G
NPHP4     7-0353-003chr1:
5971623-5971623
CTintronicDe novo--Trost2022 G
NPHP4     1-0835-003chr1:
6013206-6013206
GAintronicDe novo--Trost2022 G
Yuen2017 G
NPHP4     AU1640302chr1:
6013988-6013988
GTintronicDe novo--Trost2022 G
Yuen2017 G
NPHP4     DEASD_4035_001chr1:
5927725-5927725
GAintronicDe novo--Fu2022 E
NPHP4     2-1567-003chr1:
6006125-6006125
CAintronicDe novo--Trost2022 G
Yuen2017 G
NPHP4     11879-1chr1:
6046273-6046273
TGexonicDe novononsynonymous SNVNM_015102c.A77Cp.K26T13.54-Fu2022 E
NPHP4     2-1356-003chr1:
5940091-5940106
GCACACACACACACACGCACACACACACACintronicDe novo--Yuen2017 G
NPHP4     AU3724301chr1:
5929016-5929016
AATGCintronicDe novo--Yuen2017 G
NPHP4     2-1241-003chr1:
6014128-6014128
TGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
NPHP4     JASD_Fam0236chr1:
5935138-5935138
TCexonicDe novononsynonymous SNVNM_001291594
NM_001291593
NM_015102
c.A1304G
c.A1301G
c.A2840G
p.Q435R
p.Q434R
p.Q947R
10.73-Takata2018 E
NPHP4     mAGRE2463chr1:
5927859-5927863
TGATATexonicPaternalframeshift deletionNM_001291594
NM_001291593
NM_015102
c.1873_1876del
c.1870_1873del
c.3409_3412del
p.Y625fs
p.Y624fs
p.Y1137fs
-8.311E-6Cirnigliaro2023 G
NPHP4     Cukier2014:17122chr1:
5965455-5965455
CTexonicUnknownnonsynonymous SNVNM_001291594
NM_001291593
NM_015102
c.G316A
c.G313A
c.G1852A
p.E106K
p.E105K
p.E618K
16.890.0103Cukier2014 E
NPHP4     SP0061913chr1:
6027473-6027473
ACintronicDe novo--Fu2022 E
NPHP4     5-0046-003chr1:
5977532-5977532
GAintronicDe novo--Trost2022 G
Yuen2017 G
NPHP4     iHART3087chr1:
5969253-5969253
GAexonicPaternalstopgainNM_015102c.C1462Tp.R488X37.01.0E-4Ruzzo2019 G
NPHP4     SP0044787chr1:
6012732-6012733
GCGintronicDe novo-8.0E-4Fu2022 E
NPHP4     iHART3086chr1:
5969253-5969253
GAexonicPaternalstopgainNM_015102c.C1462Tp.R488X37.01.0E-4Ruzzo2019 G
NPHP4     SP0100138chr1:
5937413-5937413
ATintronicDe novo--Fu2022 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More