or
or
Exact

Results for "SRRM2"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SRRM2     SP0131716chr16:
2811529-2811529
AGintronicDe novo--Fu2022 E
SRRM2     09C87498chr16:
2806450-2806450
CTexonicDe novononsynonymous SNVNM_016333c.C85Tp.R29C12.435.536E-5DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Zhou2022 GE
SRRM2     14042_p1chr16:
2815265-2815265
CAexonicDe novononsynonymous SNVNM_016333c.C4736Ap.S1579Y12.57-Fu2022 E
SRRM2     DEASD_0082_001chr16:
2813308-2813312
CAAAGCexonicDe novoframeshift deletionNM_016333c.2780_2783delp.Q927fs--DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRRM2     CC963_202chr16:
2815249-2815249
CTexonicDe novononsynonymous SNVNM_016333c.C4720Tp.R1574W1.3173.296E-5Fu2022 E
SRRM2     SMHC01752s000chr16:
2806552-2806552
ATexonicDe novostopgainNM_016333c.A187Tp.K63X37.0-Yuan2023 E
SRRM2     AU205Achr16:
2815676-2815676
CAexonicDe novononsynonymous SNVNM_016333c.C5147Ap.T1716N8.538-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRRM2     SP0031674chr16:
2810569-2810569
AATGTTCATTGGATTGCAAATGTATAGATTTAGGATintronicDe novo--Fu2022 E
SRRM2     NDAR_INVZA317AMM_wes1chr16:
2817038-2817038
CGexonicDe novononsynonymous SNVNM_016333c.C6509Gp.T2170R5.924-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRRM2     12238.p1chr16:
2815062-2815062
CTexonicDe novosynonymous SNVNM_016333c.C4533Tp.T1511T--Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Trost2022 G
Wilfert2021 G
Zhou2022 GE
SRRM2     14042.p1chr16:
2815265-2815265
CAexonicDe novononsynonymous SNVNM_016333c.C4736Ap.S1579Y12.57-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRRM2     2-0045-003chr16:
2813215-2813215
CTexonicDe novononsynonymous SNVNM_016333c.C2686Tp.P896S0.008-Yuen2016 G
Yuen2017 G
Zhou2022 GE
SRRM2     11946.p1chr16:
2819139-2819139
CTexonicsynonymous SNVNM_016333c.C7875Tp.S2625S-1.0E-4Zhou2022 GE
SRRM2     AU4122301chr16:
2818694-2818702
GGAAGGAGAGGAAGGAGAAGGAGAintronicDe novo--Yuen2017 G
SRRM2     13283.p1chr16:
2811996-2811996
CTexonicDe novosynonymous SNVNM_016333c.C1467Tp.T489T-8.258E-6Krumm2015 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SRRM2     SP0008634chr16:
2816707-2816707
CTexonicDe novostopgainNM_016333c.C6178Tp.R2060X48.0-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
SRRM2     AU2140305chr16:
2811174-2811174
CGintronicDe novo--Yuen2017 G
SRRM2     SP0005299chr16:
2814076-2814080
CAGAACexonicDe novoframeshift deletionNM_016333c.3548_3551delp.Q1183fs--Antaki2022 GE
Fu2022 E
Zhou2022 GE
SRRM2     JASD_Fam0212chr16:
2814953-2814953
GAexonicDe novononsynonymous SNVNM_016333c.G4424Ap.R1475K11.33-Takata2018 E
SRRM2     CC963.202chr16:
2815249-2815249
CTexonicDe novononsynonymous SNVNM_016333c.C4720Tp.R1574W1.3173.296E-5Satterstrom2020 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More