or
or
Exact

Results for "ERBIN"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ERBIN     AU4465303chr5:
65382041-65382041
GAintergenicDe novo--Yuen2017 G
ERBIN     2-1353-003chr5:
65408317-65408331
GCACACACACACACAGCACACACACACAintergenicDe novo--Yuen2017 G
ERBIN     14304.p1chr5:
65334296-65334296
CTexonicDe novononsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1292T
c.C1292T
c.C1292T
c.C1292T
c.C1292T
c.C1292T
p.P431L
p.P431L
p.P431L
p.P431L
p.P431L
p.P431L
21.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
ERBIN     219-2257-1chr5:
65290623-65290623
GTexonicUnknownnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G238T
c.G238T
c.G238T
c.G238T
c.G238T
c.G238T
p.D80Y
p.D80Y
p.D80Y
p.D80Y
p.D80Y
p.D80Y
26.2-Stessman2017 T
ERBIN     2-1195-003chr5:
65435456-65435469
GCACACACACACACGCACACACACACintergenicDe novo--Yuen2017 G
ERBIN     2-0304-003chr5:
65401532-65401532
GAintergenicDe novo--Yuen2017 G
ERBIN     AU076808chr5:
65276108-65276108
GAintronicDe novo--Yuen2017 G
ERBIN     220-9982-202chr5:
65322133-65322133
GAexonicUnknownnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G1024A
c.G1024A
c.G1024A
c.G1024A
c.G1024A
c.G1024A
p.G342R
p.G342R
p.G342R
p.G342R
p.G342R
p.G342R
27.2-Stessman2017 T
ERBIN     5-0017-004chr5:
65436615-65436615
CAintergenicDe novo--Yuen2017 G
ERBIN     AU0959302chr5:
65339997-65339997
CAexonicPaternalstopgainNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
c.C1461A
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
p.Y487X
36.0-Stessman2017 T
ERBIN     AU3190305chr5:
65270780-65270780
CGintronicDe novo--Yuen2017 G
ERBIN     AU0039303chr5:
65253257-65253257
CAintronicDe novo--Yuen2017 G
ERBIN     5-0109-003chr5:
65265616-65265616
AGintronicDe novo--Yuen2017 G
ERBIN     Viggiano2022:105.3chr5:
65350373-65350373
GTexonicPaternalnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G3227T
c.G3227T
c.G3227T
c.G3227T
c.G3215T
c.G3227T
p.R1076L
p.R1076L
p.R1076L
p.R1076L
p.R1072L
p.R1076L
22.1-Viggiano2022 GT
ERBIN     1-0119-004chr5:
65250144-65250144
AGintronicDe novo--Yuen2017 G
ERBIN     7-0273-003chr5:
65250786-65250786
AGintronicDe novo--Yuen2017 G
ERBIN     NDAR_INVGJ169ZP5_wes1chr5:
65338903-65338903
ATsplicingDe novosplicing19.68-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
ERBIN     iHART3227chr5:
65322152-65322154
CTGCexonicPaternalframeshift deletionNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
--Ruzzo2019 G
ERBIN     211-5610-3chr5:
65350583-65350583
GAexonicUnknownnonsynonymous SNVNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.G3437A
c.G3437A
c.G3437A
c.G3437A
c.G3425A
c.G3437A
p.R1146Q
p.R1146Q
p.R1146Q
p.R1146Q
p.R1142Q
p.R1146Q
24.74.128E-5Stessman2017 T
ERBIN     iHART3230chr5:
65322152-65322154
CTGCexonicPaternalframeshift deletionNM_001006600
NM_001253697
NM_001253698
NM_001253699
NM_001253701
NM_018695
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
c.1044_1045del
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
p.T348fs
--Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More