or
or
Exact

Results for "ADGRB3"

Variant Events: 67

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADGRB3     1-0651-003chr6:
70073807-70073807
CAintronicDe novo--Yuen2017 G
ADGRB3     1-0593-003chr6:
69770617-69770617
TCintronicDe novo--Yuen2017 G
ADGRB3     AU2787301chr6:
69976069-69976069
CTintronicDe novo--Yuen2017 G
ADGRB3     AU1698302chr6:
69986202-69986202
ACintronicDe novo--Yuen2017 G
ADGRB3     5-0045-003chr6:
69513428-69513428
AGintronicDe novo--Yuen2017 G
ADGRB3     AU076509chr6:
69604882-69604882
CAintronicDe novo--Yuen2017 G
ADGRB3     2-1729-003chr6:
70294744-70294744
CTintergenicDe novo--Yuen2017 G
ADGRB3     AU4365302chr6:
70161141-70161141
CGintergenicDe novo--Yuen2017 G
ADGRB3     AU028305chr6:
70342334-70342334
GAintergenicDe novo--Yuen2017 G
ADGRB3     AU076509chr6:
69601840-69601840
CAintronicDe novo--Yuen2017 G
ADGRB3     2-1434-003chr6:
70031161-70031161
AGintronicDe novo--Yuen2017 G
ADGRB3     AU056803chr6:
70362926-70362930
AATTAAAintergenicDe novo--Yuen2017 G
ADGRB3     1-0435-003chr6:
69646362-69646362
AGintronicDe novo--Yuen2017 G
ADGRB3     1-0625-003chr6:
69774179-69774179
TCintronicDe novo--Yuen2017 G
ADGRB3     7-0192-003chr6:
69689921-69689921
AGintronicDe novo--Yuen2017 G
ADGRB3     AU3765303chr6:
69918106-69918106
CTintronicDe novo--Yuen2017 G
ADGRB3     1-0079-003chr6:
69543899-69543899
GGCTTAintronicDe novo--Yuen2017 G
ADGRB3     1-0826-003chr6:
69589433-69589433
TCintronicDe novo--Yuen2017 G
ADGRB3     AU038703chr6:
69707219-69707219
GAintronicDe novo--Yuen2017 G
ADGRB3     AU4473301chr6:
70232096-70232096
TCintergenicDe novo--Yuen2017 G
ADGRB3     AU4359301chr6:
70017942-70017942
GAintronicDe novo--Yuen2017 G
ADGRB3     2-1250-003chr6:
69810696-69810696
AAGGintronicDe novo--Yuen2017 G
ADGRB3     2-0304-004chr6:
69759608-69759608
GCintronicDe novo--Yuen2017 G
ADGRB3     2-1506-003chr6:
69982328-69982328
TCintronicDe novo--Yuen2017 G
ADGRB3     2-1292-004chr6:
70292895-70292895
GAintergenicDe novo--Yuen2017 G
ADGRB3     1-0271-003chr6:
69683451-69683451
ACintronicDe novo--Yuen2017 G
ADGRB3     10C109058chr6:
69666660-69666660
CTexonicDe novononsynonymous SNVNM_001704c.C1484Tp.T495M14.123.296E-5Satterstrom2020 E
ADGRB3     2-0016-003chr6:
70068813-70068828
GTATATATATATATATGTATATATATATATintronicDe novo--Yuen2017 G
ADGRB3     2-0713-003chr6:
69757536-69757536
TAintronicDe novo--Yuen2017 G
ADGRB3     2-1127-003chr6:
69819095-69819095
TCintronicDe novo--Yuen2016 G
Yuen2017 G
ADGRB3     2-1689-003chr6:
70334283-70334283
TCintergenicDe novo--Yuen2017 G
ADGRB3     1-0490-003chr6:
69535456-69535456
CGintronicDe novo--Yuen2017 G
ADGRB3     1-0518-003chr6:
69462639-69462639
GTintronicDe novo--Yuen2016 G
Yuen2017 G
ADGRB3     1-0067-004chr6:
69503319-69503321
ATCAintronicDe novo--Yuen2017 G
ADGRB3     MT_160chr6:
69685183-69685183
CTexonicMaternalnonsynonymous SNVNM_001704c.C1685Tp.P562L31.0-Toma2013 E
ADGRB3     11002.p1chr6:
69509532-69509532
AGintronicDe novo--Turner2016 G
ADGRB3     1-0547-003chr6:
69840522-69840522
GCintronicDe novo--Yuen2017 G
ADGRB3     7-0082-003chr6:
69810696-69810696
AAGGintronicDe novo--Yuen2017 G
ADGRB3     3-0391-000chr6:
69422659-69422659
TGintronicDe novo--Yuen2017 G
ADGRB3     2-1632-003chr6:
69447838-69447838
GAintronicDe novo--Yuen2017 G
ADGRB3     1-0756-003chr6:
69663044-69663044
ATintronicDe novo--Yuen2017 G
ADGRB3     5-0015-004chr6:
69373947-69373947
GAintronicDe novo--Yuen2017 G
ADGRB3     AU3713301chr6:
70019988-70019988
ATintronicDe novo--Yuen2017 G
ADGRB3     AU075803chr6:
69702393-69702393
GAintronicDe novo--Yuen2017 G
ADGRB3     AU4284301chr6:
69542296-69542296
CTintronicDe novo--Yuen2017 G
ADGRB3     AU3649304chr6:
70274333-70274333
CTintergenicDe novo--Yuen2017 G
ADGRB3     5-0146-003chr6:
70139903-70139903
AGintergenicDe novo--Yuen2017 G
ADGRB3     AU4463303chr6:
69643002-69643002
ACintronicDe novo--Yuen2017 G
ADGRB3     1-0171-005chr6:
70200333-70200333
CGintergenicDe novo--Yuen2017 G
ADGRB3     1-0986-003chr6:
69348649-69348649
TAexonicDe novononsynonymous SNVNM_001704c.T82Ap.F28I14.66-Yuen2017 G
ADGRB3     AU056804chr6:
69696369-69696369
CAintronicDe novo--Yuen2017 G
ADGRB3     1572023chr6:
69666672-69666672
TGexonicDe novononsynonymous SNVNM_001704c.T1496Gp.V499G16.93-Satterstrom2020 E
ADGRB3     12550.p1chr6:
70034815-70034815
TAexonicDe novononsynonymous SNVNM_001704c.T2866Ap.F956I35.0-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
ADGRB3     1-0303-004chr6:
70062915-70062915
GAintronicDe novo--Yuen2017 G
ADGRB3     AU3761301chr6:
69660013-69660013
TAintronicDe novo--Yuen2017 G
ADGRB3     AU056204chr6:
69908329-69908329
TGintronicDe novo--Yuen2017 G
ADGRB3     1-0582-003chr6:
69999391-69999391
CTintronicDe novo--Yuen2017 G
ADGRB3     2-1252-003chr6:
70280966-70280966
ACintergenicDe novo--Yuen2017 G
ADGRB3     AU073003chr6:
69755701-69755701
TCintronicDe novo--Yuen2017 G
ADGRB3     1-0353-003chr6:
69768286-69768286
ATintronicDe novo--Yuen2017 G
ADGRB3     2-1086-004chr6:
70132918-70132918
CTintergenicDe novo--Yuen2017 G
ADGRB3     AU4069302chr6:
70018257-70018257
AGintronicDe novo--Yuen2017 G
ADGRB3     AU076704chr6:
69472261-69472261
CTintronicDe novo--Yuen2017 G
ADGRB3     2-1129-003chr6:
70154961-70154961
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADGRB3     EGAN00001101298chr6:
69942475-69942475
CTintronicDe novo1.329-Satterstrom2020 E
ADGRB3     1-0144-005chr6:
69810696-69810696
AAGGintronicDe novo--Yuen2017 G
ADGRB3     AU3937301chr6:
69755135-69755135
ACintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More