or
or
Exact

Results for "DIP2C"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DIP2C     AU3721302chr10:
662269-662269
TCintronicDe novo--Yuen2017 G
DIP2C     AU4462302chr10:
610524-610524
CGintronicDe novo--Yuen2017 G
DIP2C     AU4462302chr10:
614237-614237
AGintronicDe novo--Yuen2017 G
DIP2C     AU4462302chr10:
615315-615315
AGintronicDe novo--Yuen2017 G
DIP2C     3-0458-000Bchr10:
451246-451246
CAintronicDe novo--Yuen2017 G
DIP2C     AU055004chr10:
819488-819488
CGintergenicDe novo--Yuen2017 G
DIP2C     1-0871-003chr10:
800394-800394
ACintergenicDe novo--Yuen2017 G
DIP2C     AU4365302chr10:
612784-612784
GAintronicDe novo--Yuen2017 G
DIP2C     7-0253-004chr10:
638493-638493
TGintronicDe novo--Yuen2017 G
DIP2C     2-0305-003chr10:
491459-491459
TAintronicDe novo--Yuen2017 G
DIP2C     1-0971-003chr10:
675215-675215
CTintronicDe novo--Yuen2017 G
DIP2C     2-1086-003chr10:
725508-725508
CCTCTGintronicDe novo--Yuen2017 G
DIP2C     1-0368-004chr10:
424678-424678
AAAGACACGTGAACACACATGCACintronicDe novo--Yuen2017 G
DIP2C     12705.p1 Complex Event; expand row to view variants  De novoframeshift insertionNM_014974
NM_014974
c.1969dupG
c.1968dupG
p.A657fs
p.A657fs
--Dong2014 E
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
DIP2C     2-0273-003chr10:
430130-430130
AGintronicDe novo--Yuen2017 G
DIP2C     2-1213-003chr10:
400631-400631
GAintronicDe novo--Yuen2017 G
DIP2C     AU3124304chr10:
717287-717287
CCAGintronicDe novo--Yuen2017 G
DIP2C     2-0011-004chr10:
570796-570796
GAintronicDe novo--Yuen2017 G
DIP2C     AU3779302chr10:
733715-733715
GCintronicDe novo--Yuen2017 G
DIP2C     1-0144-004chr10:
772653-772653
GAintergenicDe novo--Yuen2017 G
DIP2C     2-0270-004chr10:
398437-398437
GCintronicDe novo--Yuen2017 G
DIP2C     AU1848302chr10:
636250-636250
TCintronicDe novo--Yuen2017 G
DIP2C     AU4359301chr10:
821969-821969
GAintergenicDe novo--Yuen2017 G
DIP2C     3-0458-000Achr10:
451246-451246
CAintronicDe novo--Yuen2017 G
DIP2C     1-0336-003chr10:
351339-351339
AGintronicDe novo--Yuen2017 G
DIP2C     1-0112-004chr10:
685917-685917
CTintronicDe novo--Yuen2017 G
DIP2C     AU3777301chr10:
445537-445537
AGintronicDe novo--Yuen2017 G
DIP2C     AU3646301chr10:
658785-658785
GAintronicDe novo--Yuen2017 G
DIP2C     AU3724301chr10:
516452-516452
GAintronicDe novo--Yuen2017 G
DIP2C     2-1177-003chr10:
412273-412273
GGCAexonicDe novoframeshift insertionNM_014974c.2209_2210insTGp.A737fs--Yuen2016 G
DIP2C     2-0149-005chr10:
341467-341467
GGTCCCAintronicDe novo--Yuen2017 G
DIP2C     1-0487-003chr10:
567256-567256
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DIP2C     2-1335-004chr10:
477991-477991
CTintronicDe novo--Yuen2017 G
DIP2C     AU3727303chr10:
545501-545501
AGintronicDe novo--Yuen2017 G
DIP2C     AU056604chr10:
334694-334694
GAintronicDe novo--Yuen2017 G
DIP2C     1-0509-003chr10:
628393-628393
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DIP2C     5-0083-003chr10:
498669-498669
GAintronicDe novo--Yuen2017 G
DIP2C     AU4067301chr10:
325200-325200
CAintronicDe novo--Yuen2017 G
DIP2C     AU3889305chr10:
658052-658052
TCintronicDe novo--Yuen2017 G
DIP2C     AU4479301chr10:
369616-369619
CTGTCTintronicDe novo--Yuen2017 G
DIP2C     1-0560-003chr10:
659077-659077
CGintronicDe novo--Yuen2017 G
DIP2C     AU2951303chr10:
415063-415063
CTintronicDe novo--Yuen2017 G
DIP2C     3-0458-000chr10:
451246-451246
CAintronicDe novo--Yuen2016 G
DIP2C     63-343chr10:
673310-673310
CTintronicDe novo--Michaelson2012 G
DIP2C     EGAN00001101385chr10:
445023-445023
ATintronicDe novo--Satterstrom2020 E
DIP2C     2-1261-003chr10:
341467-341467
GGTCCCAintronicDe novo--Yuen2017 G
DIP2C     AU2951302chr10:
415063-415063
CTintronicDe novo--Yuen2017 G
DIP2C     2-1379-003chr10:
387534-387534
GAintronicDe novo--Yuen2017 G
DIP2C     1-0459-004chr10:
546379-546379
TCintronicDe novo--Yuen2017 G
DIP2C     2-1497-003chr10:
455214-455214
TCintronicDe novo--Yuen2017 G
DIP2C     1-0458-005chr10:
505545-505545
TTCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More