
Results for "CAPN12"

Variant Events: 28

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
CAPN12     14369.p1chr19:
GAexonicDe novononsynonymous SNVNM_144691c.C1025Tp.P342L26.96.212E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
CAPN12     14369_p1chr19:
GAexonicDe novononsynonymous SNVNM_144691c.C1025Tp.P342L26.96.212E-5Fu2022 E
CAPN12     PN400179chr19:
GGAGCGGTCGGCGCGCexonicUnknownframeshift insertionNM_144691c.1441_1442insGCGCGCCGACCGCTp.S481fs--Leblond2019 E
CAPN12     12036-1chr19:
GAAAAAGintronicDe novo--Fu2022 E
CAPN12     PN400412chr19:
GGAGCGGTCGGCGCGCexonicUnknownframeshift insertionNM_144691c.1441_1442insGCGCGCCGACCGCTp.S481fs--Leblond2019 E
CAPN12     SP0132363chr19:
AAGGGGGCTGTTTGCCCCAGCintronicDe novo-9.074E-6Fu2022 E
CAPN12     ASDFI_1513chr19:
CTexonicDe novononsynonymous SNVNM_144691c.G766Ap.V256I18.48-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CAPN12     PN400480chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     1-0286-003chr19:
CAexonicDe novosynonymous SNVNM_144691c.G255Tp.P85P--Yuen2015 G
CAPN12     PN400508chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     iHART2500chr19:
AGsplicingPaternalsplicing13.57-Ruzzo2019 G
CAPN12     SP0070757chr19:
GAUTR5De novo--Fu2022 E
CAPN12     iHART2502chr19:
AGsplicingPaternalsplicing13.57-Ruzzo2019 G
CAPN12     iHART2234chr19:
GAexonicPaternalstopgainNM_144691c.C514Tp.Q172X38.02.49E-5Ruzzo2019 G
CAPN12     PN400279chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     iHART3105chr19:
GTTGexonicMaternalframeshift deletionNM_144691c.658_659delp.N220fs-8.0E-4Ruzzo2019 G
CAPN12     SP0060149chr19:
CAPN12     PN400434chr19:
GGAGCGGTCGGCGCGCexonicUnknownframeshift insertionNM_144691c.1441_1442insGCGCGCCGACCGCTp.S481fs--Leblond2019 E
CAPN12     iHART2501chr19:
AGsplicingPaternalsplicing13.57-Ruzzo2019 G
CAPN12     iHART2715chr19:
TCsplicingPaternalsplicing10.294.201E-5Ruzzo2019 G
CAPN12     PN400517chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     PN400102chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     PN400584chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     PN400166chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     PN400114chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     GM173276chr19:
CAPN12     PN400285chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
CAPN12     PN400439chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView