or
or
Exact

Results for "SKI"

Variant Events: 13

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SKI     1-0219-003chr1:
2172553-2172553
CTintronicDe novo--Yuen2017 G
SKI     7-0141-003chr1:
2234931-2234931
GTintronicDe novo--Yuen2017 G
SKI     ASC_CA_183_Achr1:
2238195-2238200
GGAGCCGexonicDe novoframeshift deletionNM_003036c.2179_2183delp.E727fs--Satterstrom2020 E
SKI     1-0541-003chr1:
2181430-2181430
GAintronicDe novo--Yuen2017 G
SKI     08C78919chr1:
2234766-2234766
CTexonicDe novostopgainNM_003036c.C1138Tp.R380X37.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
SKI     AU4473301chr1:
2223294-2223294
AGintronicDe novo--Yuen2017 G
SKI     7-0080-003chr1:
2210987-2210987
CAintronicDe novo--Yuen2017 G
SKI     1-0567-003chr1:
2202962-2202962
CTintronicDe novo--Yuen2017 G
SKI     2-0003-004chr1:
2221058-2221058
GAintronicDe novo--Yuen2017 G
SKI     1-0300-003chr1:
2234752-2234752
GAexonicDe novononsynonymous SNVNM_003036c.G1124Ap.R375H22.58.254E-6Yuen2017 G
SKI     2-1333-003chr1:
2245855-2245884
GGCCCCGGCCTGTCCCCGGCCCTGGCGCTGGGintergenicDe novo--Yuen2017 G
SKI     A16chr1:
2227836-2227840
AAAACAintronicDe novo--Wu2018 G
SKI     2-1166-003chr1:
2173857-2173857
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More