or
or
Exact

Results for "RYR2"

Variant Events: 47

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RYR2     2-1567-004chr1:
237389566-237389566
CTintronicDe novo--Yuen2017 G
RYR2     AU2988303chr1:
237879507-237879512
TAAAAATAAAintronicDe novo--Yuen2017 G
RYR2     AU071804chr1:
237456654-237456654
GAintronicDe novo--Yuen2017 G
RYR2     AU4215302chr1:
237903974-237903974
AGintronicDe novo--Yuen2017 G
RYR2     2-0158-003chr1:
238002848-238002848
AGintergenicDe novo--Yuen2017 G
RYR2     1-0458-004chr1:
237679033-237679033
CCTGTTGintronicDe novo--Yuen2017 G
RYR2     AU066818chr1:
237568489-237568489
AGintronicDe novo--Yuen2017 G
RYR2     1-0051-004chr1:
237954798-237954798
ACexonicDe novononsynonymous SNVNM_001035c.A13546Cp.I4516L17.13-Yuen2017 G
RYR2     AU2793302chr1:
237916270-237916270
TAintronicDe novo--Yuen2017 G
RYR2     AU3368302chr1:
237683815-237683815
CTintronicDe novo--Yuen2017 G
RYR2     A17chr1:
237343785-237343785
ACintronicDe novo--Wu2018 G
RYR2     7-0067-003chr1:
237648977-237648977
TAintronicDe novo--Yuen2017 G
RYR2     AU3846303chr1:
237443617-237443617
CTintronicDe novo--Yuen2017 G
RYR2     iHART2855chr1:
237666806-237666806
GAsplicingPaternalsplicing27.8-Ruzzo2019 G
RYR2     2-1581-003chr1:
237895609-237895609
CAintronicDe novo--Yuen2017 G
RYR2     1946-23968chr1:
237659974-237659974
GAexonicInheritednonsynonymous SNVNM_001035c.G2125Ap.G709R35.0-Callaghan2019 G
RYR2     2-0110-003chr1:
237332677-237332677
CTintronicDe novo--Yuen2016 G
Yuen2017 G
RYR2     iHART2856chr1:
237666806-237666806
GAsplicingPaternalsplicing27.8-Ruzzo2019 G
RYR2     1-0320-004chr1:
237918758-237918758
CTintronicDe novo--Yuen2017 G
RYR2     1-0383-003chr1:
237589033-237589050
TGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAintronicDe novo--Yuen2017 G
RYR2     11C119398chr1:
237865361-237865361
TAsplicingDe novosplicing19.88-Satterstrom2020 E
RYR2     AU2140306chr1:
237247196-237247196
ATintronicDe novo--Yuen2017 G
RYR2     AU027506chr1:
237590350-237590350
CTintronicDe novo--Yuen2017 G
RYR2     13894.p1chr1:
237880456-237880456
GAintronicDe novo--Satterstrom2020 E
RYR2     DEASD_0115_001chr1:
237870440-237870440
CAexonicDe novononsynonymous SNVNM_001035c.C9772Ap.P3258T13.93-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
RYR2     1-0579-003chr1:
237795093-237795093
ACintronicDe novo--Yuen2017 G
RYR2     1-0965-003 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
RYR2     5-0125-003chr1:
237776993-237776993
TCintronicDe novo--Yuen2017 G
RYR2     1-0150-003chr1:
237985370-237985370
GAintronicDe novo--Yuen2017 G
RYR2     1-0751-003chr1:
237631366-237631366
GAintronicDe novo--Yuen2017 G
RYR2     722-04-103059chr1:
237850735-237850736
TGTintronicDe novo--Satterstrom2020 E
RYR2     AU3912303chr1:
237270095-237270095
CTintronicDe novo--Yuen2017 G
RYR2     1-0373-003chr1:
237398985-237398985
GCintronicDe novo--Yuen2017 G
RYR2     AU3368303chr1:
237661806-237661806
AGintronicDe novo--Yuen2017 G
RYR2     AU2793301chr1:
237689954-237689954
CTintronicDe novo--Yuen2017 G
RYR2     2-1577-003chr1:
237965419-237965419
AGintronicDe novo--Yuen2017 G
RYR2     13958.p1chr1:
237666734-237666734
CTexonicDe novononsynonymous SNVNM_001035c.C2542Tp.R848C16.388.283E-6Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
RYR2     11042.p1chr1:
237823274-237823275
CTCintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
RYR2     AU058105chr1:
237399931-237399931
ACintronicDe novo--Yuen2017 G
RYR2     AU3794302chr1:
237492203-237492203
CTintronicDe novo--Yuen2017 G
RYR2     AU3786301chr1:
237882036-237882036
GAintronicDe novo--Yuen2017 G
RYR2     1-0259-005chr1:
237471626-237471626
TCintronicDe novo--Yuen2017 G
RYR2     1-0389-004chr1:
237522812-237522812
CAintronicDe novo--Yuen2017 G
RYR2     AU2988302chr1:
237879507-237879512
TAAAAATAAAintronicDe novo--Yuen2017 G
RYR2     AU4234303chr1:
237235217-237235217
CTintronicDe novo--Yuen2017 G
RYR2     2-0307-004chr1:
237442528-237442528
GCintronicDe novo--Yuen2017 G
RYR2     AU2129303chr1:
237301912-237301912
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More