or
or
Exact

Results for "PBX1"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PBX1     AU2162302chr1:
165129112-165129125
GTATATATATATATGTATATATATATATATintergenicDe novo--Yuen2017 G
PBX1     2-1278-003chr1:
165051366-165051366
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
PBX1     AU079204chr1:
164730830-164730830
CTintronicDe novo--Yuen2017 G
PBX1     JASD_Fam0161chr1:
164769051-164769051
GCexonicDe novononsynonymous SNVNM_001204961
NM_001204963
NM_002585
c.G626C
c.G626C
c.G626C
p.S209T
p.S209T
p.S209T
34.0-Takata2018 E
PBX1     2-1452-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
PBX1     2-1619-003chr1:
164848663-164848663
GTintergenicDe novo--Yuen2017 G
PBX1     2-1086-004chr1:
164804860-164804865
CTCTTTCintronicDe novo--Yuen2017 G
PBX1     13393.p1chr1:
164761841-164761850
TCGGCGGCAGTexonicDe novononframeshift deletionNM_001204961
NM_001204963
NM_002585
c.377_385del
c.377_385del
c.377_385del
p.126_129del
p.126_129del
p.126_129del
--Satterstrom2020 E
PBX1     1-0022-004chr1:
164970955-164970955
CTintergenicDe novo--Yuen2017 G
PBX1     1-0406-003chr1:
164748303-164748303
CTintronicDe novo--Yuen2017 G
PBX1     3-0431-000chr1:
164678260-164678260
ATintronicDe novo--Yuen2016 G
Yuen2017 G
PBX1     505-09-112395chr1:
164769105-164769105
GAexonicDe novononsynonymous SNVNM_001204961
NM_001204963
NM_002585
c.G680A
c.G680A
c.G680A
p.R227H
p.R227H
p.R227H
27.6-Satterstrom2020 E
PBX1     3-0140-000chr1:
164763262-164763262
CAintronicDe novo--Yuen2017 G
PBX1     AU015903chr1:
165018814-165018814
CTintergenicDe novo--Yuen2017 G
PBX1     AU4465303chr1:
165165220-165165220
CTintergenicDe novo--Yuen2017 G
PBX1     2-0304-003chr1:
164624237-164624237
CTintronicDe novo--Yuen2017 G
PBX1     AU3913303chr1:
164946742-164946742
TGintergenicDe novo--Yuen2017 G
PBX1     2-1480-003chr1:
164961317-164961317
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
PBX1     7-0256-003chr1:
164864387-164864387
GAintergenicDe novo--Yuen2017 G
PBX1     AU3790302chr1:
165128564-165128564
TCintergenicDe novo--Yuen2017 G
PBX1     AU3801301chr1:
164944683-164944683
TCintergenicDe novo--Yuen2017 G
PBX1     1-0757-003chr1:
164973750-164973750
CAintergenicDe novo--Yuen2017 G
PBX1     2-1477-003chr1:
164807630-164807630
TCintronicDe novo--Yuen2016 G
Yuen2017 G
PBX1     A1chr1:
165024265-165024265
GAintergenicDe novo--Wu2018 G
PBX1     1-0563-003chr1:
164860033-164860033
GAintergenicDe novo--Yuen2017 G
PBX1     2-1269-003chr1:
164868232-164868232
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
PBX1     AU2123301chr1:
164933768-164933768
TGintergenicDe novo--Yuen2017 G
PBX1     1-0329-003chr1:
165135362-165135362
CGintergenicDe novo--Yuen2017 G
PBX1     2-1510-003chr1:
164769042-164769042
GCexonicDe novononsynonymous SNVNM_001204961
NM_001204963
NM_002585
c.G617C
c.G617C
c.G617C
p.R206P
p.R206P
p.R206P
33.0-Yuen2017 G
PBX1     2-1300-003chr1:
164715255-164715255
AGintronicDe novo--Yuen2017 G
PBX1     AU060703chr1:
164710908-164710908
TCintronicDe novo--Yuen2017 G
PBX1     2-1272-003chr1:
165103061-165103061
TCintergenicDe novo--Yuen2016 G
PBX1     1-0304-003chr1:
164856479-164856480
AGAintergenicDe novo--Yuen2016 G
Yuen2017 G
PBX1     2-1168-003chr1:
164700302-164700317
ATGTGTGTGTGTGTGTATGTGTGTGTGTGTintronicDe novo--Yuen2017 G
PBX1     1-0572-003chr1:
164876936-164876936
AGintergenicDe novo--Yuen2017 G
PBX1     2-0012-003chr1:
164779561-164779561
ATintronicDe novo--Yuen2017 G
PBX1     1-0138-004chr1:
164925013-164925013
CTintergenicDe novo--Yuen2017 G
PBX1     2-0007-004chr1:
164694576-164694576
GAintronicDe novo--Yuen2017 G
PBX1     08C77554chr1:
164532514-164532515
GTGexonicDe novoframeshift deletionNM_001204961
NM_001204963
NM_002585
c.232delT
c.232delT
c.232delT
p.F78fs
p.F78fs
p.F78fs
--DeRubeis2014 E
Kosmicki2017 E
PBX1     DEASD_0021_001chr1:
164790805-164790805
CTexonicDe novononsynonymous SNVNM_001204963
NM_002585
c.C1142T
c.C1142T
p.T381I
p.T381I
25.1-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
PBX1     1-0225-003chr1:
164755699-164755699
GAintronicDe novo--Yuen2017 G
PBX1     2-1605-004chr1:
165159757-165159757
TAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More