or
or
Exact

Results for "KCNS3"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KCNS3     1-0206-004chr2:
18078360-18078360
TCintronicDe novo--Yuen2017 G
KCNS3     AU3125301chr2:
18089643-18089643
GTintronicDe novo--Yuen2017 G
KCNS3     2-0002-005chr2:
18674185-18674189
AAAGAAAintergenicDe novo--Yuen2017 G
KCNS3     AU4308302chr2:
18449724-18449724
CAintergenicDe novo--Yuen2017 G
KCNS3     2-0273-003chr2:
18466582-18466582
TGintergenicDe novo--Yuen2017 G
KCNS3     1-0404-003chr2:
18202340-18202340
GAintergenicDe novo--Yuen2017 G
KCNS3     AU2129303chr2:
18089486-18089486
AGintronicDe novo--Yuen2017 G
KCNS3     1-0148-005chr2:
18288293-18288293
TCintergenicDe novo--Yuen2017 G
KCNS3     1-0534-003chr2:
18377417-18377417
CAintergenicDe novo--Yuen2017 G
KCNS3     2-0158-003chr2:
18685092-18685092
TCintergenicDe novo--Yuen2017 G
KCNS3     150942042chr2:
18113537-18113538
TGTexonicDe novoframeshift deletionNM_001282428
NM_002252
c.1263delG
c.1263delG
p.V421fs
p.V421fs
--Satterstrom2020 E
KCNS3     AU4056302chr2:
18515864-18515864
TAintergenicDe novo--Yuen2017 G
KCNS3     1-0638-003chr2:
18681505-18681505
AGintergenicDe novo--Yuen2017 G
KCNS3     13942.p1chr2:
18196573-18196573
GAintergenicDe novo--Turner2016 G
KCNS3     1-0075-003chr2:
18521662-18521662
TGintergenicDe novo--Yuen2017 G
KCNS3     AU3787303chr2:
18149335-18149335
CTintergenicDe novo--Yuen2017 G
KCNS3     1-0155-003chr2:
18370002-18370002
CTintergenicDe novo--Yuen2017 G
KCNS3     AU2975302chr2:
18478844-18478844
ATintergenicDe novo--Yuen2017 G
KCNS3     1-0273-004chr2:
18274703-18274703
AGintergenicDe novo--Yuen2017 G
KCNS3     1-0571-003chr2:
18633038-18633038
CTintergenicDe novo--Yuen2017 G
KCNS3     2-1137-003chr2:
18276496-18276496
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
KCNS3     2-1223-003chr2:
18431478-18431480
TGGTGintergenicDe novo--Yuen2017 G
KCNS3     1-0196-005chr2:
18285519-18285519
GAintergenicDe novo--Yuen2017 G
KCNS3     AU066404chr2:
18475082-18475090
TGATTATAATGATTATAAGATTATAAintergenicDe novo--Yuen2017 G
KCNS3     5-0128-003chr2:
18536102-18536102
CAintergenicDe novo--Yuen2017 G
KCNS3     AU3857301chr2:
18206090-18206090
CTintergenicDe novo--Yuen2017 G
KCNS3     7-0141-003chr2:
18390703-18390703
CGintergenicDe novo--Yuen2017 G
KCNS3     7-0161-003chr2:
18368361-18368361
ACintergenicDe novo--Yuen2017 G
KCNS3     AU4093304chr2:
18354546-18354546
TCintergenicDe novo--Yuen2017 G
KCNS3     AU3900302chr2:
18203358-18203358
TGintergenicDe novo--Yuen2017 G
KCNS3     10C117850chr2:
18113537-18113538
TGTexonicDe novoframeshift deletionNM_001282428
NM_002252
c.1263delG
c.1263delG
p.V421fs
p.V421fs
--DeRubeis2014 E
Kosmicki2017 E
KCNS3     2-1427-003chr2:
18402123-18402123
CGintergenicDe novo--Yuen2017 G
KCNS3     AU0780302chr2:
18255631-18255631
TCintergenicDe novo--Yuen2017 G
KCNS3     iHART3056chr2:
18113611-18113611
CTexonicPaternalstopgainNM_001282428
NM_002252
c.C1336T
c.C1336T
p.Q446X
p.Q446X
37.02.471E-5Ruzzo2019 G
KCNS3     iHART3055chr2:
18113611-18113611
CTexonicPaternalstopgainNM_001282428
NM_002252
c.C1336T
c.C1336T
p.Q446X
p.Q446X
37.02.471E-5Ruzzo2019 G
KCNS3     2-1241-003chr2:
18557713-18557713
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More