or
or
Exact

Results for "ZBTB18"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZBTB18     AU049304chr1:
244435693-244435693
CTintergenicDe novo--Yuen2017 G
ZBTB18     1-0190-003chr1:
244336459-244336459
AGintergenicDe novo--Yuen2017 G
ZBTB18     1-0481-003chr1:
244511883-244511883
TCintergenicDe novo--Yuen2017 G
ZBTB18     1-0558-003chr1:
244397726-244397746
GGCTGCTGCTGCTGCTGCTGCGGCTGCTGCTGCTGCTGCintergenicDe novo--Yuen2017 G
ZBTB18     13951.p1chr1:
244436347-244436347
ACintergenicDe novo--Turner2016 G
ZBTB18     1-0433-003chr1:
244292226-244292226
ACintergenicDe novo--Yuen2017 G
ZBTB18     NDAR_INVVH064RG2_wes1chr1:
244218501-244218501
CTexonicDe novosynonymous SNVNM_006352
NM_001278196
NM_205768
c.C1398T
c.C1398T
c.C1425T
p.H466H
p.H466H
p.H475H
2.1868.315E-6DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
ZBTB18     2-1142-003chr1:
244261081-244261081
CAintergenicDe novo--Yuen2017 G
ZBTB18     2-0019-004chr1:
244240214-244240214
TAintergenicDe novo--Yuen2017 G
ZBTB18     AU2117302chr1:
244380287-244380287
GAintergenicDe novo--Yuen2017 G
ZBTB18     HN0267.p1chr1:
244217773-244217773
CTexonicDe novostopgainNM_006352
NM_001278196
NM_205768
c.C670T
c.C670T
c.C697T
p.Q224X
p.Q224X
p.Q233X
32.0-Wang2020 T
Wang2020 T
ZBTB18     AU3858303chr1:
244399746-244399746
CGintergenicDe novo--Yuen2017 G
ZBTB18     1-0155-003chr1:
244390851-244390851
ATintergenicDe novo--Yuen2017 G
ZBTB18     AU2165301chr1:
244463543-244463543
CGintergenicDe novo--Yuen2017 G
ZBTB18     2-0129-004chr1:
244306519-244306519
ATintergenicDe novo--Yuen2017 G
ZBTB18     2-0225-004chr1:
244225806-244225806
CTintergenicDe novo--Yuen2017 G
ZBTB18     2-1338-003chr1:
244224943-244224943
GTintergenicDe novo--Yuen2017 G
ZBTB18     AU072504chr1:
244360507-244360507
GAintergenicDe novo--Yuen2017 G
ZBTB18     SP0041539chr1:
244218437-244218437
ATexonicDe novononsynonymous SNVNM_006352
NM_001278196
NM_205768
c.A1334T
c.A1334T
c.A1361T
p.K445M
p.K445M
p.K454M
17.12-Feliciano2019 E
ZBTB18     2-0198-003chr1:
244291737-244291737
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More