or
or
Exact

Results for "LRPPRC"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LRPPRC     3-0661-000chr2:
44372666-44372666
CTintergenicDe novo--Yuen2017 G
LRPPRC     1-0489-003chr2:
44325931-44325931
GAintergenicDe novo--Yuen2016 G
LRPPRC     1-0160-004chr2:
44184103-44184103
CCTTTATGTTTATCTTTCAGCTTTintronicDe novo--Yuen2017 G
LRPPRC     2-0304-003chr2:
44183798-44183798
GAintronicDe novo--Yuen2017 G
LRPPRC     DEASD_0094_001chr2:
44184566-44184566
GAexonicDe novononsynonymous SNVNM_133259c.C1607Tp.S536L8.105-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
LRPPRC     14547.p1chr2:
44129266-44129266
TTAintronicDe novo--Wilfert2021 G
LRPPRC     AU027506chr2:
44309439-44309439
CTintergenicDe novo--Yuen2017 G
LRPPRC     2-1497-003chr2:
44364063-44364063
CGintergenicDe novo--Yuen2017 G
LRPPRC     AU1987302chr2:
44208751-44208751
GAintronicDe novo--Yuen2017 G
LRPPRC     2-1497-003chr2:
44357893-44357893
CTintergenicDe novo--Yuen2017 G
LRPPRC     AU3874303chr2:
44153171-44153171
CTintronicDe novo--Yuen2017 G
LRPPRC     14370.p1chr2:
44304702-44304702
ACintergenicDe novo--Turner2016 G
LRPPRC     14370.p1chr2:
44307263-44307263
GAintergenicDe novo--Turner2016 G
LRPPRC     472-05-104142chr2:
44171063-44171063
GCintronicDe novo-8.843E-6Satterstrom2020 E
LRPPRC     3-0456-000chr2:
44251644-44251644
GAintergenicDe novo--Yuen2017 G
LRPPRC     2-1407-003chr2:
44319876-44319879
CTTTCTintergenicDe novo--Yuen2017 G
LRPPRC     13874.p1chr2:
44330854-44330854
CTintergenicDe novo--Turner2016 G
LRPPRC     5-0087-003chr2:
44236184-44236184
TGintergenicDe novo--Yuen2017 G
LRPPRC     1-0271-004chr2:
44189484-44189484
ACintronicDe novo--Yuen2017 G
LRPPRC     1-0344-003chr2:
44330984-44330984
ATintergenicDe novo--Yuen2017 G
LRPPRC     3-0456-000Bchr2:
44251644-44251644
GAintergenicDe novo--Yuen2017 G
LRPPRC     3-0456-000Bchr2:
44255830-44255830
TCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More