or
or
Exact

Results for "TBX15"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TBX15     AU4433301chr1:
119548996-119548996
AGintergenicDe novo--Yuen2017 G
TBX15     AU2075302chr1:
119452421-119452421
GCintronicDe novo--Yuen2017 G
TBX15     1-0445-003chr1:
119433424-119433424
ACintronicDe novo--Yuen2017 G
TBX15     1-0469-005chr1:
119483211-119483211
GTintronicDe novo--Yuen2017 G
TBX15     2-0142-003chr1:
119559090-119559090
CAintergenicDe novo--Yuen2017 G
TBX15     1-0487-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
TBX15     AU1742302chr1:
119550748-119550748
GAintergenicDe novo--Yuen2017 G
TBX15     11225.p1chr1:
119499045-119499046
ACTAintronicMaternal--Wilfert2021 G
TBX15     2-1696-003chr1:
119543735-119543735
GCintergenicDe novo--Yuen2017 G
TBX15     3-0140-000chr1:
119454587-119454587
TCintronicDe novo--Yuen2017 G
TBX15     1-0593-003chr1:
119558722-119558722
TCintergenicDe novo--Yuen2017 G
TBX15     1-0191-004chr1:
119559090-119559090
CAintergenicDe novo--Yuen2017 G
TBX15     AU4269301chr1:
119494687-119494687
CTintronicDe novo--Yuen2017 G
TBX15     1-0552-003chr1:
119547466-119547479
CTGTGTGTGTGTGTCTGTGTGTGTGTintergenicDe novo--Yuen2017 G
TBX15     2-1408-004chr1:
119447834-119447834
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More