or
or
Exact

Results for "GLRX3"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GLRX3     2-1333-003chr10:
132689070-132689070
GAintergenicDe novo--Yuen2017 G
GLRX3     AU4092302chr10:
132105586-132105586
CTintergenicDe novo--Yuen2017 G
GLRX3     1-0936-003chr10:
132028229-132028229
CTintergenicDe novo--Yuen2017 G
GLRX3     AU4152303chr10:
132334034-132334034
GAintergenicDe novo--Yuen2017 G
GLRX3     2-1178-003chr10:
131971787-131971787
TCintronicDe novo--Yuen2016 G
Yuen2017 G
GLRX3     2-1299-003chr10:
132435915-132435915
CTintergenicDe novo--Yuen2017 G
GLRX3     5-0077-004chr10:
132580863-132580863
CTintergenicDe novo--Yuen2017 G
GLRX3     AU4347301chr10:
132386644-132386644
TCintergenicDe novo--Yuen2017 G
GLRX3     AU3517301chr10:
132717820-132717820
GAintergenicDe novo--Yuen2017 G
GLRX3     AU4079302chr10:
132087501-132087501
AGintergenicDe novo--Yuen2017 G
GLRX3     2-1085-004chr10:
132616066-132616066
GTintergenicDe novo--Yuen2017 G
GLRX3     1-0007-003chr10:
132310836-132310836
CTintergenicDe novo--Yuen2017 G
GLRX3     2-0238-003chr10:
132510777-132510777
ATintergenicDe novo--Yuen2017 G
GLRX3     AU2792301chr10:
132496512-132496512
CAintergenicDe novo--Yuen2017 G
GLRX3     13825.p1chr10:
132418892-132418892
GAintergenicDe novo--Wilfert2021 G
GLRX3     2-1089-004chr10:
132254021-132254021
CCAintergenicDe novo--Yuen2017 G
GLRX3     AU3725302chr10:
132094136-132094136
CTintergenicDe novo--Yuen2017 G
GLRX3     7-0012-003chr10:
132716173-132716173
CTintergenicDe novo--Yuen2017 G
GLRX3     2-1254-003chr10:
132682466-132682466
GAintergenicDe novo--Yuen2017 G
GLRX3     1-0547-003chr10:
132362528-132362545
CTGTGTGTGTGTGTGTGTCTGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
GLRX3     AU046708chr10:
132144554-132144554
CTintergenicDe novo--Yuen2017 G
GLRX3     1-0627-003chr10:
132683893-132683898
TGGGGGTGGGGintergenicDe novo--Yuen2017 G
GLRX3     2-0270-003chr10:
132259933-132259933
CTintergenicDe novo--Yuen2017 G
GLRX3     5-0017-004chr10:
132248714-132248714
GAintergenicDe novo--Yuen2017 G
GLRX3     AU3645301chr10:
132410054-132410054
CTintergenicDe novo--Yuen2017 G
GLRX3     2-1715-003chr10:
132591686-132591686
CTintergenicDe novo--Yuen2017 G
GLRX3     1-0345-003chr10:
132576798-132576798
GAintergenicDe novo--Yuen2017 G
GLRX3     1-0417-003chr10:
132599616-132599616
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GLRX3     14482.p1chr10:
132386831-132386831
CGintergenicDe novo--Turner2016 G
GLRX3     2-1292-003chr10:
132286881-132286881
GAintergenicDe novo--Yuen2017 G
GLRX3     1-0104-004chr10:
132182873-132182873
GGCAAACCAACCAACCTACCAACAAACCAACCAAintergenicDe novo--Yuen2017 G
GLRX3     2-1220-003chr10:
132071576-132071576
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
GLRX3     5-0030-003chr10:
132551523-132551523
TTAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More