or
or
Exact

Results for "LINC01065"

Variant Events: 32

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
LINC01065   1-0699-003chr13:
53911661-53911661
AGintergenicDe novo--Yuen2017 G
LINC01065   AU054304chr13:
53839128-53839128
GCintergenicDe novo--Yuen2017 G
LINC01065   1-0244-003chr13:
54222098-54222098
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01065   1-0065-004chr13:
54013177-54013179
CATCintergenicDe novo--Yuen2017 G
LINC01065   5-0133-003chr13:
54058063-54058063
CTintergenicDe novo--Yuen2017 G
LINC01065   1-0606-003chr13:
54161563-54161568
ACACCAACACCACCAintergenicDe novo--Yuen2017 G
LINC01065   AU060803chr13:
53933331-53933331
AGintergenicDe novo--Yuen2017 G
LINC01065   1-0985-003chr13:
53737453-53737453
AGintergenicDe novo--Yuen2017 G
LINC01065   1-0271-003chr13:
54241891-54241891
TCintergenicDe novo--Yuen2017 G
LINC01065   AU3881302chr13:
54314711-54314711
ATintergenicDe novo--Yuen2017 G
LINC01065   2-1177-003chr13:
54208880-54208880
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01065   2-1352-003chr13:
54346331-54346331
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01065   AU060403chr13:
54043849-54043866
CAAAGTAACAAATTTTAACAAintergenicDe novo--Yuen2017 G
LINC01065   2-0318-004chr13:
54160359-54160359
AGintergenicDe novo--Yuen2017 G
LINC01065   12829.p1chr13:
53976894-53976894
GTintergenicDe novo--Wilfert2021 G
LINC01065   1-0494-003Achr13:
54141785-54141785
CTintergenicDe novo--Yuen2017 G
LINC01065   2-1461-003chr13:
54308110-54308110
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
LINC01065   AU054103chr13:
54088144-54088144
GCintergenicDe novo--Yuen2017 G
LINC01065   2-1508-003chr13:
53832220-53832220
TCintergenicDe novo--Yuen2017 G
LINC01065   2-1506-003chr13:
54080008-54080008
GTintergenicDe novo--Yuen2017 G
LINC01065   AU4467302chr13:
53940843-53940843
AGintergenicDe novo--Yuen2017 G
LINC01065   AU4264302chr13:
54071314-54071314
TCintergenicDe novo--Yuen2017 G
LINC01065   2-0143-004chr13:
54033539-54033539
TCintergenicDe novo--Yuen2017 G
LINC01065   AU4033303chr13:
54189708-54189708
ATintergenicDe novo--Yuen2017 G
LINC01065   5-0015-004chr13:
53853653-53853653
CAintergenicDe novo--Yuen2017 G
LINC01065   2-1522-003chr13:
54304431-54304431
AGintergenicDe novo--Yuen2017 G
LINC01065   AU0638302chr13:
54225171-54225171
GAintergenicDe novo--Yuen2017 G
LINC01065   1-0494-003chr13:
54141785-54141785
CTintergenicDe novo--Yuen2017 G
LINC01065   2-1342-003chr13:
53720539-53720539
CTncRNA_intronicDe novo--Yuen2016 G
Yuen2017 G
LINC01065   1-0804-003chr13:
53839466-53839466
TCintergenicDe novo--Yuen2017 G
LINC01065   3-0482-000chr13:
54132124-54132124
CTintergenicDe novo--Yuen2017 G
LINC01065   1-0569-003chr13:
54020756-54020756
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More