or
or
Exact

Results for "SCP2"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SCP2     PN400117chr1:
53480667-53480667
GAexonicUnknownnonsynonymous SNVNM_001193599
NM_001193600
NM_001193617
NM_002979
c.G1115A
c.G1055A
c.G944A
c.G1187A
p.G372E
p.G352E
p.G315E
p.G396E
27.74.119E-5Leblond2019 E
SCP2     Li2017:18377chr1:
53453802-53453802
GAexonicUnknownnonsynonymous SNVNM_001007098
NM_001193599
NM_001193600
NM_001193617
NM_002979
c.G943A
c.G1003A
c.G943A
c.G832A
c.G1075A
p.A315T
p.A335T
p.A315T
p.A278T
p.A359T
35.05.02E-5Li2017 T
SCP2     PN400557chr1:
53480667-53480667
GAexonicUnknownnonsynonymous SNVNM_001193599
NM_001193600
NM_001193617
NM_002979
c.G1115A
c.G1055A
c.G944A
c.G1187A
p.G372E
p.G352E
p.G315E
p.G396E
27.74.119E-5Leblond2019 E
SCP2     Li2017:30chr1:
53442442-53442442
GCsplicingUnknownsplicing25.1-Li2017 T
SCP2     11712.p1 Complex Event; expand row to view variants  De novoframeshift deletion, frameshift insertionNM_001193599
NM_001193617
NM_002979
NM_001193599
NM_001193617
NM_002979
c.208_209del
c.37_38del
c.280_281del
c.207_208insTG
c.36_37insTG
c.279_280insTG
p.C70fs
p.C13fs
p.C94fs
p.N69fs
p.N12fs
p.N93fs
--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
SCP2     11002.p1chr1:
53496631-53496631
CTintronicDe novo--Turner2016 G
SCP2     1-0606-003chr1:
53503925-53503939
TACACACACACACACTACACACACACACintronicDe novo--Yuen2017 G
SCP2     Li2017:20274chr1:
53442442-53442442
GCsplicingUnknownsplicing25.1-Li2017 T
SCP2     A30chr1:
53512699-53512699
CGintronicDe novo--Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More