or
or
Exact

Results for "SLK"

Variant Events: 6

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLK     SP0010857chr10:
105762822-105762822
AGexonicDe novononsynonymous SNVNM_001304743
NM_014720
c.A1886G
c.A1886G
p.D629G
p.D629G
2.0-Fu2022 E
SLK     2-1295-003chr10:
105768025-105768025
CTexonicDe novononsynonymous SNVNM_001304743
NM_014720
c.C2695T
c.C2695T
p.R899C
p.R899C
29.48.264E-6Jiang2013 G
Yuen2016 G
Yuen2017 G
SLK     1-0330-004chr10:
105757802-105757802
AGintronicDe novo--Yuen2017 G
SLK     CC1041_203chr10:
105752504-105752504
GGAGTAAAGTTGTAAATACCTTTTTGTTCTTTCTGTTCATATCTTAAATTATACTTGATAAGATGAAAGAATTTCAACCATATATAAATATATTCAAATATGTAAGTATCTintronicDe novo--Fu2022 E
SLK     AU3787303chr10:
105738153-105738153
CTintronicDe novo--Yuen2017 G
SLK     AU005213chr10:
105750852-105750852
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More