
Results for "LRFN2"

Variant Events: 36

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
LRFN2     2-0149-004chr6:
AGintergenicDe novo--Yuen2017 G
LRFN2     AC05-0002-01chr6:
TGexonicDe novosynonymous SNVNM_020737c.A1770Cp.A590A-1.0E-4Fu2022 E
LRFN2     SSC02460chr6:
CTexonicDe novononsynonymous SNVNM_020737c.G1160Ap.S387N0.993-Fu2022 E
LRFN2     AU031403chr6:
GAintergenicDe novo--Yuen2017 G
LRFN2     AU4159301chr6:
CTintergenicDe novo--Yuen2017 G
LRFN2     SSC11825chr6:
CACexonicDe novoframeshift deletionNM_020737c.642delTp.P214fs--Fu2022 E
LRFN2     2-1632-003chr6:
ACintergenicDe novo--Yuen2017 G
LRFN2     2-1328-003chr6:
AAGCACCintronicDe novo--Yuen2016 G
LRFN2     AU2793301chr6:
GAintergenicDe novo--Yuen2017 G
LRFN2     AU2035301chr6:
GAintronicDe novo--Yuen2017 G
LRFN2     12493.p1chr6:
CGintronicDe novo--Turner2016 G
LRFN2     2-1522-003chr6:
GTintronicDe novo--Yuen2017 G
LRFN2     11002.p1chr6:
GAintergenicDe novo--Turner2016 G
LRFN2     1-0169-003chr6:
TTGGTGAintergenicDe novo--Yuen2017 G
LRFN2     1-0190-003chr6:
CTintergenicDe novo--Yuen2017 G
LRFN2     AU3779302chr6:
AGintergenicDe novo--Yuen2017 G
LRFN2     13393.p1chr6:
CTintergenicDe novo--Turner2016 G
LRFN2     72-1397chr6:
CTexonicInheritednonsynonymous SNVNM_020737c.G362Ap.R121Q18.422.475E-5Patowary2019 E
LRFN2     AU011604chr6:
TCintergenicDe novo--Yuen2017 G
LRFN2     2-1375-003chr6:
CAintergenicDe novo--Yuen2017 G
LRFN2     1-0292-005chr6:
GAintronicDe novo--Yuen2017 G
LRFN2     2-1178-003chr6:
LRFN2     AU026412chr6:
GCintergenicDe novo--Yuen2017 G
LRFN2     11234.p1chr6:
CTexonicDe novononsynonymous SNVNM_020737c.G1160Ap.S387N0.993-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
LRFN2     14477.p1chr6:
CACexonicDe novoframeshift deletionNM_020737c.642delTp.P214fs--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
LRFN2     1-0498-003chr6:
CTintronicDe novo--Yuen2017 G
LRFN2     2-0285-003chr6:
AGintergenicDe novo--Yuen2017 G
LRFN2     1-0458-005chr6:
TTGGCintergenicDe novo--Yuen2017 G
LRFN2     1-0936-003chr6:
GAintergenicDe novo--Yuen2017 G
LRFN2     1-0923-003chr6:
GAintronicDe novo--Yuen2017 G
LRFN2     2-1169-003chr6:
TTAGTAATAATGATGGTTACAintergenicDe novo--Yuen2017 G
LRFN2     2-1195-003chr6:
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
LRFN2     1-0459-003chr6:
LRFN2     AU2035302chr6:
GAintronicDe novo--Yuen2017 G
LRFN2     2-1440-003chr6:
CTintronicDe novo--Yuen2016 G
Yuen2017 G
LRFN2     AU4306302chr6:
AGintergenicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView