Variant Results

or

or

Results for "BAHD1"

Variant Events: 8

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
BAHD1	1-0560-003	chr15: 40748165-40748187	ATGTTGTTGTTGTTGTTGTTGTT	ATGTTGTTGTTGTTGTTGTT	intronic		De novo					-	-	Yuen2017 G
BAHD1	A19	chr15: 40757171-40757171	C	T	intronic		De novo					-	-	Wu2018 G
BAHD1	Shi2013:2	chr15: 40751592-40751592	T	A	exonic		Inherited	nonsynonymous SNV	NM_001301132 NM_014952	c.T929A c.T929A	p.L310Q p.L310Q	16.24	4.218E-5	Shi2013 G
BAHD1	Shi2013:1	chr15: 40751592-40751592	T	A	exonic		Inherited	nonsynonymous SNV	NM_001301132 NM_014952	c.T929A c.T929A	p.L310Q p.L310Q	16.24	4.218E-5	Shi2013 G
BAHD1	SMHC01815s000	chr15: 40756720-40756720	G	A	exonic		De novo	nonsynonymous SNV	NM_001301132 NM_014952	c.G2023A c.G2026A	p.G675R p.G676R	33.0	-	Yuan2023 E
BAHD1	SP0136462	chr15: 40751309-40751309	A	C	exonic		De novo	nonsynonymous SNV	NM_001301132 NM_014952	c.A646C c.A646C	p.S216R p.S216R	20.6	-	Fu2022 E
BAHD1	SP0041645	chr15: 40750758-40750758	A	T	exonic		De novo	nonsynonymous SNV	NM_001301132 NM_014952	c.A95T c.A95T	p.Q32L p.Q32L	13.78	-	Feliciano2019 E Fu2022 E
BAHD1	09C81661	chr15: 40758109-40758109	A	G	intronic		De novo					-	2.0E-4	Satterstrom2020 E

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More