or
or
Exact

Results for "BCAP29"

Variant Events: 7

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
BCAP29     A4chr7:
107279730-107279730
AGintergenicDe novo--Wu2018 G
BCAP29     Codina-Sola2015:ASD_32chr7:
107254094-107254144
TACAGCATTCCAGTTTTGGTGAATTTTTAAGCAAAAGAAGCCACAAAAATGTexonicPaternalframeshift deletionNM_001008405c.691_736delp.H231fs-0.0031Codina-Sola2015 E
BCAP29     SP0072750chr7:
107240863-107240863
GCexonicDe novononsynonymous SNVNM_001008405
NM_018844
c.G502C
c.G502C
p.D168H
p.D168H
14.84-Fu2022 E
BCAP29     1-0338-005chr7:
107275516-107275516
CGintergenicDe novo--Yuen2017 G
BCAP29     G01_GEA526HIchr7:
107234294-107234294
GTintronicDe novo--Fu2022 E
BCAP29     AU2140306chr7:
107238808-107238808
CTintronicDe novo--Yuen2017 G
BCAP29     iHART2661chr7:
107221310-107221310
GTsplicingMaternalsplicing18.87-Ruzzo2019 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More