or
or
Exact

Results for "DYRK1A"

Variant Events: 104

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DYRK1A     JS0001.p1chr21:
38850489-38850489
CGexonicMaternalnonsynonymous SNVNM_001396
NM_130438
NM_101395
c.C214G
c.C214G
c.C214G
p.P72A
p.P72A
p.P72A
14.36-Guo2018 T
DYRK1A     iHART3005chr21:
38850482-38850482
GAsplicingPaternalsplicing20.3-Ruzzo2019 G
DYRK1A     M13341chr21:
38878450-38878450
CTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1595T
c.C1568T
c.C1595T
p.T532M
p.T523M
p.T532M
34.01.0E-4Guo2018 T
Wang2016 T
DYRK1A     YN0002.p1chr21:
38884422-38884422
GAexonicMaternalnonsynonymous SNVNM_001396
NM_130436
c.G1880A
c.G1853A
p.R627Q
p.R618Q
16.143.296E-5Guo2018 T
DYRK1A     M12327chr21:
38877659-38877659
GAexonicDe novo, Unknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.G1313A
c.G1286A
c.G1313A
c.G1313A
p.R438H
p.R429H
p.R438H
p.R438H
27.5-Guo2018 T
Li2017 T
Stessman2017 T
Wang2016 T
DYRK1A     HN0026.p1chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Guo2018 T
DYRK1A     Stessman2017:ASD_1448chr21:
38865349-38865349
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C982T
c.C955T
c.C982T
c.C982T
p.R328W
p.R319W
p.R328W
p.R328W
34.0-Stessman2017 T
DYRK1A     Husson2020:47chr21:
38862575-38862575
CTexonicstopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C763T
c.C736T
c.C763T
c.C763T
p.R255X
p.R246X
p.R255X
p.R255X
50.0-Husson2020 E
DYRK1A     M21761chr21:
38865398-38865398
TCexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1031C
c.T1004C
c.T1031C
c.T1031C
p.M344T
p.M335T
p.M344T
p.M344T
26.12.471E-5Guo2018 T
Wang2016 T
DYRK1A     SSC06885chr21:
38877891-38877906
AGGTCTGTGCTGCTGCAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1546_1546del
c.1519_1519del
c.1546_1546del
c.1546_1546del
p.G516fs
p.G507fs
p.G516fs
p.G516fs
--Fu2022 E
Trost2022 G
DYRK1A     6239chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Fu2022 E
Trost2022 G
DYRK1A     TRE_99chr21:
38884758-38884758
TCexonicDe novononsynonymous SNVNM_001396
NM_130436
c.T2216C
c.T2189C
p.M739T
p.M730T
11.338.237E-6Fu2022 E
DYRK1A     HEN0102.p1chr21:
38878525-38878526
AGAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_101395
c.1671delG
c.1644delG
c.1671delG
p.Q557fs
p.Q548fs
p.Q557fs
--Guo2018 T
DYRK1A     AU3638302chr21:
38973654-38973655
TCTCCintergenicDe novo--Yuen2017 G
DYRK1A     7-0255-003chr21:
38934134-38934134
CAintergenicDe novo--Yuen2017 G
DYRK1A     ACGC_M20274chr21:
38853069-38853069
GTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.G457T
c.G430T
c.G457T
c.G457T
p.E153X
p.E144X
p.E153X
p.E153X
49.0-Wang2020 T
DYRK1A     SP0061913chr21:
38862465-38862470
TTTCTCTintronicDe novo--Fu2022 E
Zhou2022 GE
DYRK1A     SAGE_BK_606.02chr21:
38850501-38850501
AATexonicPaternalframeshift insertionNM_001396
NM_130438
NM_101395
c.227dupT
c.227dupT
c.227dupT
p.M76fs
p.M76fs
p.M76fs
--Wang2020 T
DYRK1A     SP0070890chr21:
38877891-38877891
ACexonicDe novosynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.A1545C
c.A1518C
c.A1545C
c.A1545C
p.S515S
p.S506S
p.S515S
p.S515S
--Fu2022 E
DYRK1A     SP0076309chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Fu2022 E
Trost2022 G
Zhou2022 GE
DYRK1A     ACGC_M12327chr21:
38877659-38877659
GAexonicDe novononsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.G1313A
c.G1286A
c.G1313A
c.G1313A
p.R438H
p.R429H
p.R438H
p.R438H
27.5-Wang2020 T
DYRK1A     SP0047593chr21:
38792647-38792647
TAUTR5De novo--Fu2022 E
DYRK1A     ACGC_HEN0102.p1chr21:
38878525-38878526
AGAexonicDe novoframeshift deletionNM_001396
NM_130436
NM_101395
c.1671delG
c.1644delG
c.1671delG
p.Q557fs
p.Q548fs
p.Q557fs
--Wang2020 T
DYRK1A     SP0037073chr21:
38792647-38792647
TAUTR5De novo--Fu2022 E
DYRK1A     13890.p1chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lowther2023 G
O’Roak2012a T
O’Roak2012b E
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
vanBon2015 T
DYRK1A     13256.p1chr21:
38877891-38877906
AGGTCTGTGCTGCTGCAexonicDe novo, Unknownframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1546_1546del
c.1519_1519del
c.1546_1546del
c.1546_1546del
p.G516fs
p.G507fs
p.G516fs
p.G516fs
--Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wang2020 T
Zhou2022 GE
DYRK1A     1-0640-003chr21:
38931481-38931481
CAintergenicDe novo--Yuen2017 G
DYRK1A     HEN0229.p1chr21:
38878564-38878564
CTexonicPaternalnonsynonymous SNVNM_101395c.C1709Tp.A570V14.38-Guo2018 T
DYRK1A     1-0150-004chr21:
38965489-38965491
TGATintergenicDe novo--Yuen2017 G
DYRK1A     M23240chr21:
38865398-38865398
TCexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1031C
c.T1004C
c.T1031C
c.T1031C
p.M344T
p.M335T
p.M344T
p.M344T
26.12.471E-5Wang2016 T
DYRK1A     1-0233-004chr21:
38960115-38960115
CAintergenicDe novo--Yuen2017 G
DYRK1A     1-1090-003chr21:
38816947-38816947
CTintronicDe novo--Trost2022 G
DYRK1A     AU2448301chr21:
38812730-38812730
CTintronicDe novo--Trost2022 G
DYRK1A     2-1509-003chr21:
38781371-38781371
CTintronicDe novo--Trost2022 G
Yuen2017 G
DYRK1A     SSC04381chr21:
38845116-38845118
CATCexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.142_143del
c.142_143del
c.142_143del
c.142_143del
p.I48fs
p.I48fs
p.I48fs
p.I48fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
DYRK1A     MT_170.3chr21:
38770851-38770851
ATintronicDe novo--Trost2022 G
DYRK1A     MT_170.3chr21:
38769982-38769982
CGintronicDe novo--Trost2022 G
DYRK1A     M30369chr21:
38877632-38877632
TCexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1286C
c.T1259C
c.T1286C
c.T1286C
p.V429A
p.V420A
p.V429A
p.V429A
27.81.649E-5Guo2018 T
DYRK1A     HN0045.p1chr21:
38878596-38878596
GTexonicPaternalnonsynonymous SNVNM_101395c.G1741Tp.V581L11.67-Guo2018 T
DYRK1A     1-0862-003chr21:
38812845-38812847
CTACintronicDe novo--Trost2022 G
Yuen2017 G
DYRK1A     1-0683-004chr21:
38993148-38993149
TCAAintergenicDe novo--Trost2022 G
DYRK1A     M26749chr21:
38878594-38878594
ATexonicPaternalnonsynonymous SNVNM_101395c.A1739Tp.Q580L11.44-Guo2018 T
Wang2016 T
DYRK1A     SSC08031chr21:
38877833-38877834
GCGexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1488delC
c.1461delC
c.1488delC
c.1488delC
p.S496fs
p.S487fs
p.S496fs
p.S496fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
DYRK1A     MSSNG00333-003chr21:
38879292-38879292
CGintronicDe novo--Trost2022 G
DYRK1A     SAGE_546.03chr21:
38845116-38845118
CATCexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.142_143del
c.142_143del
c.142_143del
c.142_143del
p.I48fs
p.I48fs
p.I48fs
p.I48fs
--Wang2020 T
DYRK1A     MSSNG00429-003chr21:
38870611-38870611
TCintronicDe novo--Trost2022 G
DYRK1A     SAGE_544.03chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Wang2020 T
DYRK1A     REACH000540chr21:
38845637-38845637
CTintronicDe novo--Trost2022 G
DYRK1A     REACH000435chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Antaki2022 GE
Trost2022 G
Zhou2022 GE
DYRK1A     3-0781-000chr21:
38839499-38839499
CGintronicDe novo--Trost2022 G
DYRK1A     SP0018047chr21:
38852950-38852950
CCAexonicDe novoframeshift insertionNM_001396
NM_130436
NM_130438
NM_101395
c.339dupA
c.312dupA
c.339dupA
c.339dupA
p.A113fs
p.A104fs
p.A113fs
p.A113fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
DYRK1A     7-0240-004chr21:
38836508-38836508
AGintronicDe novo--Trost2022 G
DYRK1A     SSC09554chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Antaki2022 GE
Chan2022 G
DYRK1A     MSSNG00133-003chr21:
38830378-38830378
GAintronicDe novo--Trost2022 G
DYRK1A     SP0093881chr21:
38862575-38862575
CTexonicstopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C763T
c.C736T
c.C763T
c.C763T
p.R255X
p.R246X
p.R255X
p.R255X
50.0-Antaki2022 GE
Zhou2022 GE
DYRK1A     SJD_15.3chr21:
38822364-38822364
TCintronicDe novo--Trost2022 G
DYRK1A     B0326chr21:
38868526-38868526
CGexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1205G
c.C1178G
c.C1205G
c.C1205G
p.T402S
p.T393S
p.T402S
p.T402S
9.1827.452E-5Xiong2019 ET
DYRK1A     M32128chr21:
38878489-38878489
CTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1634T
c.C1607T
c.C1634T
p.A545V
p.A536V
p.A545V
34.08.32E-6Guo2018 T
DYRK1A     SAGE_553.03chr21:
38877833-38877834
GCGexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1488delC
c.1461delC
c.1488delC
c.1488delC
p.S496fs
p.S487fs
p.S496fs
p.S496fs
--Wang2020 T
DYRK1A     Hu2022:20chr21:
38865397-38865404
ATGTGGTCAexonicUnknownframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1031_1037del
c.1004_1010del
c.1031_1037del
c.1031_1037del
p.M344fs
p.M335fs
p.M344fs
p.M344fs
--Hu2022 T
DYRK1A     AU048204chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Stessman2017 T
DYRK1A     ACGC_HN0026.p1chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Wang2020 T
DYRK1A     M20274chr21:
38853069-38853069
GTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.G457T
c.G430T
c.G457T
c.G457T
p.E153X
p.E144X
p.E153X
p.E153X
49.0-Guo2018 T
Stessman2017 T
Stessman2017 T
Wang2016 T
DYRK1A     AGRE_AU048204chr21:
38862503-38862503
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C691T
c.C664T
c.C691T
c.C691T
p.R231X
p.R222X
p.R231X
p.R231X
50.0-Wang2020 T
DYRK1A     13552.p1 Complex Event; expand row to view variants  De novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
NM_001396
NM_130436
NM_130438
NM_101395
NM_001396
NM_130436
NM_130438
NM_101395
c.1488delC
c.1461delC
c.1488delC
c.1488delC
c.1489delC
c.1462delC
c.1489delC
c.1489delC
c.1491delC
c.1464delC
c.1491delC
c.1491delC
p.S496fs
p.S487fs
p.S496fs
p.S496fs
p.P497fs
p.P488fs
p.P497fs
p.P497fs
p.P497fs
p.P488fs
p.P497fs
p.P497fs
--Dong2014 E
Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lowther2023 G
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Willsey2013 E
Zhou2022 GE
vanBon2015 T
DYRK1A     12099.p1 Complex Event; expand row to view variants  De novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
NM_001396
NM_130436
NM_130438
NM_101395
c.142_143del
c.142_143del
c.142_143del
c.142_143del
c.143_144del
c.143_144del
c.143_144del
c.143_144del
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
p.I48fs
--Dong2014 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Lowther2023 G
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
vanBon2015 T
DYRK1A     M10138chr21:
38853100-38853100
CGexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C488G
c.C461G
c.C488G
c.C488G
p.S163C
p.S154C
p.S163C
p.S163C
27.6-Guo2018 T
Wang2016 T
DYRK1A     2-0286-003chr21:
38986964-38986964
GGTCTGTGTATGCGTGTGTGTATGCAintergenicDe novo--Yuen2017 G
DYRK1A     Hu2022:40chr21:
38884272-38884272
TAexonicUnknownnonsynonymous SNVNM_001396
NM_130436
c.T1730A
c.T1703A
p.V577D
p.V568D
27.3-Hu2022 T
DYRK1A     M3543chr21:
38845108-38845108
CGexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C133G
c.C133G
c.C133G
c.C133G
p.Q45E
p.Q45E
p.Q45E
p.Q45E
22.9-Wang2016 T
DYRK1A     Hu2022:44chr21:
38850489-38850489
CGexonicUnknownnonsynonymous SNVNM_001396
NM_130438
NM_101395
c.C214G
c.C214G
c.C214G
p.P72A
p.P72A
p.P72A
14.36-Hu2022 T
DYRK1A     M31009chr21:
38878489-38878489
CTexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.C1634T
c.C1607T
c.C1634T
p.A545V
p.A536V
p.A545V
34.08.32E-6Guo2018 T
DYRK1A     Gecz1_5615chr21:
38884421-38884421
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
c.C1879T
c.C1852T
p.R627W
p.R618W
16.34.119E-5Wang2020 T
DYRK1A     Gecz1_5614chr21:
38884421-38884421
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
c.C1879T
c.C1852T
p.R627W
p.R618W
16.34.119E-5Wang2020 T
DYRK1A     SAGE_BK_642.01chr21:
38877755-38877755
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1409T
c.C1382T
c.C1409T
c.C1409T
p.P470L
p.P461L
p.P470L
p.P470L
34.0-Wang2020 T
DYRK1A     HN0091.p1chr21:
38850543-38850543
AGexonicMaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.A268G
c.A241G
c.A268G
c.A268G
p.T90A
p.T81A
p.T90A
p.T90A
16.032.472E-5Guo2018 T
DYRK1A     Leuven_370627chr21:
38865398-38865398
TAexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.T1031A
c.T1004A
c.T1031A
c.T1031A
p.M344K
p.M335K
p.M344K
p.M344K
33.0-Wang2020 T
DYRK1A     Melbourne2_ASD_1448chr21:
38865349-38865349
CTexonicUnknownnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C982T
c.C955T
c.C982T
c.C982T
p.R328W
p.R319W
p.R328W
p.R328W
34.0-Wang2020 T
DYRK1A     M16139chr21:
38868526-38868526
CGexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1205G
c.C1178G
c.C1205G
c.C1205G
p.T402S
p.T393S
p.T402S
p.T402S
9.1827.452E-5Wang2016 T
DYRK1A     M17694chr21:
38868526-38868526
CGexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C1205G
c.C1178G
c.C1205G
c.C1205G
p.T402S
p.T393S
p.T402S
p.T402S
9.1827.452E-5Wang2016 T
DYRK1A     1-0224-004chr21:
38961490-38961490
GAintergenicDe novo--Yuen2017 G
DYRK1A     1-0882-003chr21:
38933426-38933426
CTintergenicDe novo--Yuen2017 G
DYRK1A     M26773chr21:
38878405-38878405
GTexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_101395
c.G1550T
c.G1523T
c.G1550T
p.G517V
p.G508V
p.G517V
25.5-Guo2018 T
Wang2016 T
DYRK1A     AU2793303chr21:
38850482-38850482
GAsplicingPaternalsplicing20.3-Cirnigliaro2023 G
DYRK1A     UMCN 2chr21:
38877584-38877584
AGsplicingDe novosplicing11.47-vanBon2015 T
DYRK1A     Murdoch CRIchr21:
38850482-38850482
GAsplicingInheritedsplicing20.3-vanBon2015 T
DYRK1A     Krgovic2022:016930chr21:
38877661-38877662
GCGexonicDe novoframeshift deletionNM_001396
NM_130436
NM_130438
NM_101395
c.1316delC
c.1289delC
c.1316delC
c.1316delC
p.A439fs
p.A430fs
p.A439fs
p.A439fs
--Krgovic2022 E
DYRK1A     ASD038chr21:
38858853-38858853
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C601T
c.C574T
c.C601T
c.C601T
p.Q201X
p.Q192X
p.Q201X
p.Q201X
48.0-Tran2020 E
Wu2019 E
DYRK1A     TAS_F0134Ychr21:
38884702-38884702
CAexonicDe novostopgainNM_001396
NM_130436
c.C2160A
c.C2133A
p.Y720X
p.Y711X
49.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
DYRK1A     GF2852chr21:
38852979-38852979
CTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C367T
c.C340T
c.C367T
c.C367T
p.Q123X
p.Q114X
p.Q123X
p.Q123X
48.0-vanBon2015 T
DYRK1A     Lim2017:6239chr21:
38865466-38865466
GAsplicingDe novosplicing28.2-Lim2017 E
DYRK1A     SF0093881.p1chr21:
38862575-38862575
CTexonicstopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C763T
c.C736T
c.C763T
c.C763T
p.R255X
p.R246X
p.R255X
p.R255X
50.0-Wang2020 T
DYRK1A     Li2017:20274chr21:
38853069-38853069
GTexonicDe novostopgainNM_001396
NM_130436
NM_130438
NM_101395
c.G457T
c.G430T
c.G457T
c.G457T
p.E153X
p.E144X
p.E153X
p.E153X
49.0-Li2017 T
DYRK1A     SF0018047.p1chr21:
38852950-38852950
CCAexonicframeshift insertionNM_001396
NM_130436
NM_130438
NM_101395
c.339dupA
c.312dupA
c.339dupA
c.339dupA
p.A113fs
p.A104fs
p.A113fs
p.A113fs
--Wang2020 T
DYRK1A     AU3610302chr21:
38879377-38879377
TGintronicDe novo--Yuen2017 G
DYRK1A     SF0076309.p1chr21:
38865466-38865466
GAsplicingsplicing28.2-Wang2020 T
DYRK1A     M23840chr21:
38878594-38878594
ATexonicPaternalnonsynonymous SNVNM_101395c.A1739Tp.Q580L11.44-Guo2018 T
DYRK1A     M03543chr21:
38845108-38845108
CGexonicPaternalnonsynonymous SNVNM_001396
NM_130436
NM_130438
NM_101395
c.C133G
c.C133G
c.C133G
c.C133G
p.Q45E
p.Q45E
p.Q45E
p.Q45E
22.9-Guo2018 T
DYRK1A     1-0150-003chr21:
38965489-38965491
TGATintergenicDe novo--Yuen2017 G
DYRK1A     10C108344chr21:
38877655-38877655
CTexonicDe novo, UnknownstopgainNM_001396
NM_130436
NM_130438
NM_101395
c.C1309T
c.C1282T
c.C1309T
c.C1309T
p.R437X
p.R428X
p.R437X
p.R437X
50.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
DYRK1A     Radboud_11-12536chr21:
38850482-38850482
GAsplicingMaternalsplicing20.3-Wang2020 T
DYRK1A     Radboud_11-12535chr21:
38850482-38850482
GAsplicingMaternalsplicing20.3-Wang2020 T
DYRK1A     3-0169-000chr21:
38758888-38758888
AGintronicDe novo--Trost2022 G
Yuen2016 G
DYRK1A     Radboud_11-21295chr21:
38850482-38850482
GAsplicingUnknownsplicing20.3-Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More