or
or
Exact

Results for "CASK"

Variant Events: 33

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CASK     1-0629-003chrX:
41969906-41969937
TCTCTCTCTCTCTCTCTCTCTCTCTCTCTCACTCintergenicDe novo--Yuen2017 G
CASK     2-1195-003chrX:
42328026-42328029
CTGACTGAGTGAintergenicDe novo--Yuen2017 G
CASK     2-0033-003chrX:
42292968-42292968
ACintergenicDe novo--Yuen2017 G
CASK     AU3911302chrX:
41838691-41838691
GAintergenicDe novo--Yuen2017 G
CASK     AU3371305chrX:
41641782-41641782
AGintronicDe novo--Yuen2017 G
CASK     1-0481-003chrX:
42565888-42565888
AGintergenicDe novo--Yuen2017 G
CASK     AU3713302chrX:
42360351-42360352
AGAintergenicDe novo--Yuen2017 G
CASK     AU3586303chrX:
41695469-41695478
CAAAAAAAAACAAAAAAAAAAintronicDe novo--Yuen2017 G
CASK     M18437chrX:
41524649-41524649
CTexonicMaternalnonsynonymous SNVNM_001126054
NM_001126055
NM_003688
c.G589A
c.G589A
c.G589A
p.G197R
p.G197R
p.G197R
32.0-Guo2018 T
Wang2016 T
CASK     SP0082038chrX:
41524649-41524649
CTexonicnonsynonymous SNVNM_001126054
NM_001126055
NM_003688
c.G589A
c.G589A
c.G589A
p.G197R
p.G197R
p.G197R
32.0-Zhou2022 GE
CASK     2-1117-003chrX:
41849526-41849526
TCintergenicDe novo--Yuen2017 G
CASK     1-0150-004chrX:
41496532-41496532
CTintronicDe novo--Yuen2017 G
CASK     7-0168-003chrX:
42448526-42448526
CTintergenicDe novo--Yuen2017 G
CASK     452-09-112086chrX:
41419074-41419087
GAAGGTAATACTCCGexonicDe novoframeshift deletionNM_001126055
NM_001126054
NM_003688
c.1664_1676del
c.1682_1694del
c.1682_1694del
p.G555fs
p.G561fs
p.G561fs
--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CASK     AU4060306chrX:
42216956-42216975
AAAAAAAAAAAAAAAAAAGAAAintergenicDe novo--Yuen2017 G
CASK     5-0033-004chrX:
42271598-42271598
AGintergenicDe novo--Yuen2017 G
CASK     AU3768302chrX:
41904518-41904518
GCintergenicDe novo--Yuen2017 G
CASK     2-1417-003chrX:
42585252-42585252
CTintergenicDe novo--Yuen2017 G
CASK     A27chrX:
42445851-42445851
CAintergenicDe novo--Wu2018 G
CASK     12648.p1chrX:
41598642-41598642
CTexonicUnknownnonsynonymous SNVNM_001126054
NM_001126055
NM_003688
c.G424A
c.G424A
c.G424A
p.V142M
p.V142M
p.V142M
26.1-Gupta2014 T
CASK     11379.p1chrX:
41524649-41524649
CTexonicDe novo, Unknownnonsynonymous SNVNM_001126054
NM_001126055
NM_003688
c.G589A
c.G589A
c.G589A
p.G197R
p.G197R
p.G197R
32.0-Gupta2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Sanders2012 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CASK     11291.p1chrX:
41469222-41469222
TCexonicUnknownnonsynonymous SNVNM_001126055
NM_001126054
NM_003688
c.A1072G
c.A1090G
c.A1090G
p.S358G
p.S364G
p.S364G
16.113.519E-5Gupta2014 T
CASK     AU4029302chrX:
41441600-41441600
GAintronicDe novo--Yuen2017 G
CASK     AU3912302chrX:
42436710-42436710
TGintergenicDe novo--Yuen2017 G
CASK     P035chrX:
41413089-41413089
CTexonicMaternalnonsynonymous SNVNM_001126055
NM_001126054
NM_003688
c.G1835A
c.G1853A
c.G1922A
p.R612K
p.R618K
p.R641K
9.6072.0E-4Long2019 ET
CASK     SP0147327chrX:
41712461-41712461
GAexonicstopgainNM_001126054
NM_001126055
NM_003688
c.C79T
c.C79T
c.C79T
p.R27X
p.R27X
p.R27X
36.0-Zhou2022 GE
CASK     AU024606chrX:
41746125-41746125
CTintronicDe novo--Yuen2017 G
CASK     7-0133-003chrX:
42492698-42492698
GAintergenicDe novo--Yuen2017 G
CASK     1-0075-003chrX:
42481539-42481559
TTGTGTGTGTGTGTGTGTGTGTTGTGTGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
CASK     AU056803chrX:
42574177-42574189
TTTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTintergenicDe novo--Yuen2017 G
CASK     AU006804chrX:
41495140-41495140
TCintronicDe novo--Yuen2017 G
CASK     AU4007301chrX:
41429241-41429260
ATTTTCTTTTCTTTTCTTTTATTTTCTTTTintronicDe novo--Yuen2017 G
CASK     AU2248302chrX:
42349471-42349471
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More