or
or
Exact

Results for "CUBN"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CUBN     1-0162-004chr10:
17158825-17158825
GCintronicDe novo--Yuen2017 G
CUBN     10C113318chr10:
16962087-16962087
CTexonicDe novosynonymous SNVNM_001081c.G6696Ap.V2232V--DeRubeis2014 E
Kosmicki2017 E
CUBN     G01-GEA-110-HIchr10:
17065605-17065605
TAintronicDe novo13.61-Satterstrom2020 E
CUBN     AU4315302chr10:
17079732-17079732
TCintronicDe novo--Yuen2017 G
CUBN     AU3951302chr10:
17130561-17130561
ATintronicDe novo--Yuen2017 G
CUBN     1-0388-003chr10:
17088958-17088958
CTintronicDe novo--Yuen2017 G
CUBN     iHART1652chr10:
16893284-16893285
CACexonicMaternalframeshift deletionNM_001081c.9612delTp.F3204fs-8.239E-6Ruzzo2019 G
CUBN     80001103032chr10:
16873414-16873414
CTexonicDe novosynonymous SNVNM_001081c.G10365Ap.V3455V--Satterstrom2020 E
CUBN     SP0022582chr10:
16882437-16882437
CTexonicDe novostopgainNM_001081c.G9924Ap.W3308X50.0-Feliciano2019 E
CUBN     iHART2310chr10:
16994388-16994389
GCGsplicingPaternalsplicing-8.242E-6Ruzzo2019 G
CUBN     111289chr10:
16946066-16946066
GCexonicnonsynonymous SNVNM_001081c.C7961Gp.P2654R22.9-Woodbury-Smith2022 E
CUBN     11316.p1chr10:
16930412-16930412
TAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
CUBN     AU3617302chr10:
17104762-17104762
GAintronicDe novo--Yuen2017 G
CUBN     13844.p1chr10:
17127755-17127755
GAexonicDe novostopgainNM_001081c.C1951Tp.R651X41.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
Willsey2013 E
CUBN     1-0150-004chr10:
16940686-16940686
TCintronicDe novo--Yuen2017 G
CUBN     AU4239301chr10:
16955064-16955064
TCintronicDe novo--Yuen2017 G
CUBN     2-1365-003chr10:
17156717-17156717
ACintronicDe novo--Yuen2017 G
CUBN     1-0777-003chr10:
17156255-17156255
TAintronicDe novo--Yuen2017 G
CUBN     AU4467302chr10:
16873859-16873859
GAintronicDe novo--Yuen2017 G
CUBN     1-0629-003chr10:
17025271-17025288
CTGTGTGTGTGTGTGTGTCTGTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
CUBN     AU4310301chr10:
17179567-17179567
GTintergenicDe novo--Yuen2017 G
CUBN     1-0232-004chr10:
17050958-17050958
AGintronicDe novo--Yuen2017 G
CUBN     2-1738-003chr10:
16875304-16875304
CTintronicDe novo--Yuen2017 G
CUBN     2-1738-003chr10:
16875409-16875409
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More