or
or
Exact

Results for "GSE1"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GSE1     AU3721301chr16:
85701911-85701911
GAexonicDe novononsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.G2984A
c.G3077A
c.G3296A
p.R995Q
p.R1026Q
p.R1099Q
0.8998.299E-6Yuen2017 G
GSE1     2-1268-003chr16:
85675315-85675315
GCintronicDe novo--Yuen2016 G
Yuen2017 G
GSE1     SP0044301chr16:
85691077-85691077
CTexonicMosaicnonsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.C1195T
c.C1288T
c.C1507T
p.R399W
p.R430W
p.R503W
20.44.222E-5Feliciano2019 E
GSE1     SP0077663chr16:
85695043-85695043
CTexonicDe novosynonymous SNVNM_001134473
NM_001278184
NM_014615
c.C1620T
c.C1713T
c.C1932T
p.A540A
p.A571A
p.A644A
0.388.801E-6Fu2022 E
GSE1     11711.p1chr16:
85690061-85690061
GAexonicDe novononsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.G790A
c.G883A
c.G1102A
p.E264K
p.E295K
p.E368K
19.58-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
GSE1     SP0107296chr16:
85689946-85689946
CTintronicDe novo-2.0E-4Fu2022 E
GSE1     11524.p1chr16:
85691078-85691078
GAexonicDe novononsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.G1196A
c.G1289A
c.G1508A
p.R399Q
p.R430Q
p.R503Q
20.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Sanders2012 E
Satterstrom2020 E
Wilfert2021 G
GSE1     SP0111986chr16:
85687871-85687871
TGintronicDe novo--Fu2022 E
GSE1     11188.p1chr16:
85697156-85697156
CTexonicDe novo, Mosaicsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.C2268T
c.C2361T
c.C2580T
p.F756F
p.F787F
p.F860F
10.644.954E-5Dou2017 E
Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
GSE1     AU082Achr16:
85689972-85689972
GGGCGGGAGAGGGAGCGCGAexonicDe novononframeshift insertionNM_001134473
NM_001278184
NM_014615
c.701_702insGCGGGAGAGGGAGCGCGA
c.794_795insGCGGGAGAGGGAGCGCGA
c.1013_1014insGCGGGAGAGGGAGCGCGA
p.R234delinsRRERERE
p.R265delinsRRERERE
p.R338delinsRRERERE
-3.671E-5Fu2022 E
GSE1     11188_p1chr16:
85697156-85697156
CTexonicDe novosynonymous SNVNM_001134473
NM_001278184
NM_014615
c.C2268T
c.C2361T
c.C2580T
p.F756F
p.F787F
p.F860F
10.644.954E-5Fu2022 E
GSE1     2-1167-003chr16:
85706336-85706336
GAUTR3De novo--Yuen2016 G
Yuen2017 G
GSE1     1-0593-003chr16:
85646460-85646460
CGintronicDe novo--Yuen2017 G
GSE1     AU3858303chr16:
85668648-85668648
GAintronicDe novo--Yuen2017 G
GSE1     SSC00558chr16:
85691078-85691078
GAexonicDe novononsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.G1196A
c.G1289A
c.G1508A
p.R399Q
p.R430Q
p.R503Q
20.2-Fu2022 E
GSE1     SP0072877chr16:
85690955-85690955
AGexonicDe novononsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.A1073G
c.A1166G
c.A1385G
p.H358R
p.H389R
p.H462R
2.189-Fu2022 E
GSE1     SP0045593chr16:
85690015-85690015
GGCexonicDe novoframeshift insertionNM_001134473
NM_001278184
NM_014615
c.744_745insC
c.837_838insC
c.1056_1057insC
p.E248fs
p.E279fs
p.E352fs
--Fu2022 E
GSE1     AU4235303chr16:
85646773-85646773
CTintronicDe novo--Yuen2017 G
GSE1     SP0099287chr16:
85702004-85702004
TCexonicDe novononsynonymous SNVNM_001134473
NM_001278184
NM_014615
c.T3077C
c.T3170C
c.T3389C
p.F1026S
p.F1057S
p.F1130S
21.0-Fu2022 E
GSE1     UK10K_SKUSE5080176chr16:
85682214-85682214
TCexonicDe novononsynonymous SNVNM_001278184
NM_014615
c.T64C
c.T283C
p.S22P
p.S95P
15.616.0E-4DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More