or
or
Exact

Results for "MAP3K13"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MAP3K13     2-0144-004chr3:
185190621-185190622
ACAintronicDe novo--Yuen2017 G
MAP3K13     1-0495-003chr3:
185149741-185149758
ATCTCTCTCTCTCTCTCTATCTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
MAP3K13     AU2215302chr3:
185139169-185139169
AGintronicDe novo--Yuen2017 G
MAP3K13     AU4465303chr3:
185203843-185203843
AGUTR3De novo--Yuen2017 G
MAP3K13     AU3808305chr3:
185000628-185000628
CAupstreamDe novo--Yuen2017 G
MAP3K13     200675453@1082034446chr3:
185198194-185198194
GAexonicDe novosynonymous SNVNM_001242317
NM_004721
NM_001242314
c.G2055A
c.G2676A
c.G2676A
p.T685T
p.T892T
p.T892T
-8.237E-6Satterstrom2020 E
MAP3K13     AU0786305chr3:
185193651-185193658
AATACATAAATACATACATAintronicDe novo--Yuen2017 G
MAP3K13     Chen2017:47chr3:
185198194-185198194
GAexonicDe novosynonymous SNVNM_001242317
NM_004721
NM_001242314
c.G2055A
c.G2676A
c.G2676A
p.T685T
p.T892T
p.T892T
-8.237E-6Chen2017 E
MAP3K13     AU4231301chr3:
185119196-185119196
CGintronicDe novo--Yuen2017 G
MAP3K13     1-0175-003chr3:
185018448-185018448
TGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More