or
or
Exact

Results for "CACNA1C"

Variant Events: 117

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CACNA1C     1-0324-003chr12:
2217705-2217705
CTintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     AU2951303chr12:
2207952-2207952
GAintronicDe novo--Yuen2017 G
CACNA1C     1-0473-003chr12:
2206438-2206438
TAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     1-0482-003chr12:
2169359-2169359
CCGAintronicDe novo--Yuen2016 G
CACNA1C     111289chr12:
2717736-2717736
GAexonicnonsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3407A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3476A
c.G3476A
c.G3476A
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1136H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1159H
p.R1159H
p.R1159H
28.9-Woodbury-Smith2022 E
CACNA1C     2-1244-003chr12:
2775890-2775890
GAexonicInheritednonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.G4532A
c.G4532A
c.G4526A
c.G4532A
c.G4532A
c.G4565A
c.G4631A
c.G4565A
c.G4565A
c.G4565A
c.G4565A
c.G4616A
c.G4565A
c.G4565A
c.G4565A
c.G4565A
c.G4556A
c.G4565A
c.G4565A
c.G4649A
c.G4625A
c.G4709A
c.G4709A
p.R1511Q
p.R1511Q
p.R1509Q
p.R1511Q
p.R1511Q
p.R1522Q
p.R1544Q
p.R1522Q
p.R1522Q
p.R1522Q
p.R1522Q
p.R1539Q
p.R1522Q
p.R1522Q
p.R1522Q
p.R1522Q
p.R1519Q
p.R1522Q
p.R1522Q
p.R1550Q
p.R1542Q
p.R1570Q
p.R1570Q
29.3-Jiang2013 G
CACNA1C     2-0306-003chr12:
2638826-2638826
AGintronicDe novo--Yuen2016 G
CACNA1C     2-1370-003chr12:
2351228-2351228
TGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CACNA1C     AU3371301chr12:
2328423-2328423
AGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     AU0146301chr12:
2190553-2190553
AGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-1477-003chr12:
2686749-2686749
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CACNA1C     AU2427302chr12:
2480749-2480749
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-0215-003chr12:
2254982-2254982
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     4-0003-003chr12:
2179863-2179863
GAintronicDe novo--Trost2022 G
CACNA1C     3-0368-000chr12:
2180930-2180930
AGintronicDe novo--Trost2022 G
CACNA1C     2-0306-004chr12:
2638826-2638826
AGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     MCD-016-3chr12:
2794928-2794928
GAexonicPaternalnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.G5624A
c.G5624A
c.G5618A
c.G5567A
c.G5600A
c.G5723A
c.G5657A
c.G5657A
c.G5657A
c.G5651A
c.G5600A
c.G5600A
c.G5600A
c.G5600A
c.G5591A
c.G5600A
c.G5780A
c.G5705A
c.G5684A
c.G5660A
c.G5705A
c.G5744A
c.G5849A
p.R1875Q
p.R1875Q
p.R1873Q
p.R1856Q
p.R1867Q
p.R1908Q
p.R1886Q
p.R1886Q
p.R1886Q
p.R1884Q
p.R1867Q
p.R1867Q
p.R1867Q
p.R1867Q
p.R1864Q
p.R1867Q
p.R1927Q
p.R1902Q
p.R1895Q
p.R1887Q
p.R1902Q
p.R1915Q
p.R1950Q
14.742.491E-5Tuncay2023 G
CACNA1C     AU3724302chr12:
2749001-2749001
CGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-1626-003chr12:
2482024-2482024
CAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     SP0039355chr12:
2690829-2690829
CCTCCTCTexonicDe novononframeshift insertionNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1960_1961insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
c.1969_1970insTCCTCT
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L654delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
p.L657delinsLLF
--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
CACNA1C     AU3964302chr12:
2365019-2365019
TCintronicDe novo--Trost2022 G
CACNA1C     7-0224-003chr12:
2365229-2365229
TCintronicDe novo--Trost2022 G
CACNA1C     MT_172.3chr12:
2252752-2252752
TCintronicDe novo--Trost2022 G
CACNA1C     4-0075-003chr12:
2285344-2285344
GAintronicDe novo--Trost2022 G
CACNA1C     5-0002-003chr12:
2247335-2247335
TGintronicDe novo--Trost2022 G
CACNA1C     MT_170.3chr12:
2249475-2249475
GTintronicDe novo--Trost2022 G
CACNA1C     1-0261-004chr12:
2299735-2299735
CTintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-1509-003chr12:
2198929-2198929
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     1-0549-003chr12:
2181244-2181244
CGintronicDe novo--Trost2022 G
CACNA1C     REACH000718chr12:
2221995-2221995
GCintronicDe novo--Trost2022 G
CACNA1C     7-0178-003chr12:
2489123-2489123
GTintronicDe novo--Trost2022 G
CACNA1C     AN16641chr12:
2717736-2717736
GAexonicUnknownnonsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3407A
c.G3416A
c.G3416A
c.G3416A
c.G3416A
c.G3476A
c.G3476A
c.G3476A
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1136H
p.R1139H
p.R1139H
p.R1139H
p.R1139H
p.R1159H
p.R1159H
p.R1159H
28.9-D’Gama2015 T
CACNA1C     5-5111-003chr12:
2500249-2500249
CTintronicDe novo--Trost2022 G
CACNA1C     2-0142-003chr12:
2468151-2468151
TTGintronicDe novo--Trost2022 G
CACNA1C     2-1086-004chr12:
2468157-2468157
TGintronicDe novo--Trost2022 G
CACNA1C     1-0057-003chr12:
2406101-2406101
CGintronicDe novo--Trost2022 G
CACNA1C     3-0178-000chr12:
2412207-2412207
TGintronicDe novo--Trost2022 G
CACNA1C     1-1005-004chr12:
2405672-2405672
CTintronicDe novo--Trost2022 G
CACNA1C     MSSNG00153-003chr12:
2589602-2589602
ATintronicDe novo--Trost2022 G
CACNA1C     MT_189.3chr12:
2590394-2590394
CTintronicDe novo--Trost2022 G
CACNA1C     4-0061-003chr12:
2576785-2576785
GAintronicDe novo--Trost2022 G
CACNA1C     7-0395-003chr12:
2581778-2581778
AATCintronicDe novo--Trost2022 G
CACNA1C     2-0299-003chr12:
2562373-2562376
CATGTGTTTCTAintronicDe novo--Trost2022 G
CACNA1C     7-0373-003chr12:
2574120-2574120
TCintronicDe novo--Trost2022 G
CACNA1C     MSSNG00401-003chr12:
2514926-2514926
GAintronicDe novo--Trost2022 G
CACNA1C     5-0038-003chr12:
2544723-2544723
CTintronicDe novo--Trost2022 G
CACNA1C     MSSNG00197-003chr12:
2699472-2699472
ATintronicDe novo--Trost2022 G
CACNA1C     SJD_23.3chr12:
2711279-2711280
TCTintronicDe novo--Trost2022 G
CACNA1C     216287chr12:
2692948-2692948
TGintronicDe novo--Trost2022 G
CACNA1C     AU066206chr12:
2244999-2244999
ACintronicDe novo--Yuen2017 G
CACNA1C     1-0158-003chr12:
2698952-2698954
GCACGGGAGintronicDe novo--Trost2022 G
CACNA1C     MSSNG00404-003chr12:
2669415-2669415
AGintronicDe novo--Trost2022 G
CACNA1C     REACH000341chr12:
2681611-2681611
TCintronicDe novo--Trost2022 G
CACNA1C     3-0832-000chr12:
2658825-2658825
TCintronicDe novo--Trost2022 G
CACNA1C     3-0515-001chr12:
2665556-2665560
CAGCATACCGintronicDe novo--Trost2022 G
CACNA1C     SP0032351chr12:
2788856-2788856
CTexonicDe novononsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.C5362T
c.C5362T
c.C5356T
c.C5305T
c.C5305T
c.C5338T
c.C5461T
c.C5338T
c.C5395T
c.C5395T
c.C5395T
c.C5389T
c.C5338T
c.C5338T
c.C5338T
c.C5338T
c.C5329T
c.C5338T
c.C5338T
c.C5422T
c.C5398T
c.C5482T
c.C5482T
p.R1788C
p.R1788C
p.R1786C
p.R1769C
p.R1769C
p.R1780C
p.R1821C
p.R1780C
p.R1799C
p.R1799C
p.R1799C
p.R1797C
p.R1780C
p.R1780C
p.R1780C
p.R1780C
p.R1777C
p.R1780C
p.R1780C
p.R1808C
p.R1800C
p.R1828C
p.R1828C
9.0535.386E-5Trost2022 G
CACNA1C     14283.p1chr12:
2717804-2717804
GCexonicMosaic, De novononsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3475C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3544C
c.G3544C
c.G3544C
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1159L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1182L
p.V1182L
p.V1182L
29.3-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
Zhou2022 GE
CACNA1C     1-1037-003chr12:
2759444-2759444
GAintronicDe novo--Trost2022 G
CACNA1C     1552001chr12:
2693714-2693714
CTexonicDe novononsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2261T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
c.C2270T
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
p.A754V
p.A757V
p.A757V
p.A757V
p.A757V
p.A757V
31.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CACNA1C     AU055603chr12:
2782447-2782447
ACintronicDe novo--Trost2022 G
CACNA1C     AU2622301chr12:
2727785-2727785
AGintronicDe novo--Trost2022 G
CACNA1C     4-0073-003chr12:
2728409-2728410
CAGCintronicDe novo--Trost2022 G
CACNA1C     36081chr12:
2717804-2717804
GCexonicDe novononsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3475C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3544C
c.G3544C
c.G3544C
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1159L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1182L
p.V1182L
p.V1182L
29.3-Trost2022 G
CACNA1C     1-1044-003chr12:
2721952-2721952
AGintronicDe novo--Trost2022 G
CACNA1C     5-0041-003chr12:
2674564-2674564
CAintronicDe novo--Yuen2017 G
CACNA1C     3-0090-001chr12:
2803255-2803255
TCUTR3De novo--Trost2022 G
CACNA1C     7-0097-003chr12:
2545591-2545591
CTintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-1368-003chr12:
2587931-2587931
CTintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CACNA1C     1-0292-005chr12:
2771268-2771268
CCCTACAGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     Schaaf2011:2chr12:
2566833-2566833
CTexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
c.C718T
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
p.R240C
19.41-Schaaf2011 T
CACNA1C     1-0120-003chr12:
2609270-2609270
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     Schaaf2011:3chr12:
2595423-2595423
TCexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
c.T911C
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
p.I304T
3.0615.0E-4Schaaf2011 T
CACNA1C     Mahjani2021:27 Complex Event; expand row to view variants  nonsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
NM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3069G
c.C3078G
c.C3078G
c.C3078G
c.C3078G
c.C3138G
c.C3138G
c.C3138G
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3068A
c.T3077A
c.T3077A
c.T3077A
c.T3077A
c.T3137A
c.T3137A
c.T3137A
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1023M
p.I1026M
p.I1026M
p.I1026M
p.I1026M
p.I1046M
p.I1046M
p.I1046M
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1023N
p.I1026N
p.I1026N
p.I1026N
p.I1026N
p.I1046N
p.I1046N
p.I1046N
23.0-Mahjani2021 E
Mahjani2021 E
CACNA1C     Schaaf2011:6chr12:
2694639-2694639
GAexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2428A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
c.G2437A
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
p.G810R
p.G813R
p.G813R
p.G813R
p.G813R
p.G813R
18.583.074E-5Schaaf2011 T
CACNA1C     Schaaf2011:7chr12:
2694651-2694651
CTexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2440T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
c.C2449T
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
p.P814S
p.P817S
p.P817S
p.P817S
p.P817S
p.P817S
16.450.0035Schaaf2011 T
CACNA1C     Schaaf2011:4chr12:
2614069-2614069
GTexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_199460
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1175T
c.G1166T
c.G1175T
c.G1175T
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G392V
p.G389V
p.G392V
p.G392V
23.38.63E-6Schaaf2011 T
CACNA1C     AU1725302chr12:
2301150-2301150
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     Schaaf2011:5chr12:
2659186-2659186
GAexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1459A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
c.G1468A
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
p.G487R
p.G490R
p.G490R
p.G490R
p.G490R
p.G490R
20.48.0E-4Schaaf2011 T
CACNA1C     Schaaf2011:10chr12:
2786373-2786373
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.G4966A
c.G4966A
c.G4960A
c.G4909A
c.G4909A
c.G4942A
c.G5065A
c.G4942A
c.G4999A
c.G4999A
c.G4999A
c.G4993A
c.G4942A
c.G4942A
c.G4942A
c.G4942A
c.G4933A
c.G4942A
c.G4942A
c.G5026A
c.G5002A
c.G5086A
c.G5086A
p.A1656T
p.A1656T
p.A1654T
p.A1637T
p.A1637T
p.A1648T
p.A1689T
p.A1648T
p.A1667T
p.A1667T
p.A1667T
p.A1665T
p.A1648T
p.A1648T
p.A1648T
p.A1648T
p.A1645T
p.A1648T
p.A1648T
p.A1676T
p.A1668T
p.A1696T
p.A1696T
14.168.678E-5Schaaf2011 T
CACNA1C     Schaaf2011:11chr12:
2788616-2788616
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.G5122A
c.G5122A
c.G5116A
c.G5065A
c.G5065A
c.G5098A
c.G5221A
c.G5098A
c.G5155A
c.G5155A
c.G5155A
c.G5149A
c.G5098A
c.G5098A
c.G5098A
c.G5098A
c.G5089A
c.G5098A
c.G5098A
c.G5182A
c.G5158A
c.G5242A
c.G5242A
p.G1708S
p.G1708S
p.G1706S
p.G1689S
p.G1689S
p.G1700S
p.G1741S
p.G1700S
p.G1719S
p.G1719S
p.G1719S
p.G1717S
p.G1700S
p.G1700S
p.G1700S
p.G1700S
p.G1697S
p.G1700S
p.G1700S
p.G1728S
p.G1720S
p.G1748S
p.G1748S
23.83.0E-4Schaaf2011 T
CACNA1C     Schaaf2011:8chr12:
2706409-2706409
TGexonicUnknownnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129837
NM_001129839
NM_001129842
NM_001129844
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
c.T2798G
c.T2807G
c.T2807G
c.T2807G
c.T2807G
p.F936C
p.F936C
p.F936C
p.F936C
p.F936C
p.F936C
p.F936C
p.F936C
p.F936C
p.F936C
p.F933C
p.F936C
p.F936C
p.F936C
p.F936C
17.54-Schaaf2011 T
CACNA1C     Schaaf2011:9chr12:
2719827-2719827
GAexonicUnknownnonsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3670A
c.G3679A
c.G3679A
c.G3679A
c.G3679A
c.G3739A
c.G3739A
c.G3739A
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1224I
p.V1227I
p.V1227I
p.V1227I
p.V1227I
p.V1247I
p.V1247I
p.V1247I
14.062.479E-5Schaaf2011 T
CACNA1C     Schaaf2011:14chr12:
2788901-2788901
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.G5407A
c.G5407A
c.G5401A
c.G5350A
c.G5350A
c.G5383A
c.G5506A
c.G5383A
c.G5440A
c.G5440A
c.G5440A
c.G5434A
c.G5383A
c.G5383A
c.G5383A
c.G5383A
c.G5374A
c.G5383A
c.G5383A
c.G5467A
c.G5443A
c.G5527A
c.G5527A
p.G1803R
p.G1803R
p.G1801R
p.G1784R
p.G1784R
p.G1795R
p.G1836R
p.G1795R
p.G1814R
p.G1814R
p.G1814R
p.G1812R
p.G1795R
p.G1795R
p.G1795R
p.G1795R
p.G1792R
p.G1795R
p.G1795R
p.G1823R
p.G1815R
p.G1843R
p.G1843R
11.110.0057Schaaf2011 T
CACNA1C     Schaaf2011:15chr12:
2791829-2791829
TCexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.T5582C
c.T5582C
c.T5576C
c.T5525C
c.T5558C
c.T5681C
c.T5615C
c.T5615C
c.T5615C
c.T5609C
c.T5558C
c.T5558C
c.T5558C
c.T5558C
c.T5549C
c.T5558C
c.T5738C
c.T5663C
c.T5642C
c.T5618C
c.T5663C
c.T5702C
c.T5807C
p.L1861P
p.L1861P
p.L1859P
p.L1842P
p.L1853P
p.L1894P
p.L1872P
p.L1872P
p.L1872P
p.L1870P
p.L1853P
p.L1853P
p.L1853P
p.L1853P
p.L1850P
p.L1853P
p.L1913P
p.L1888P
p.L1881P
p.L1873P
p.L1888P
p.L1901P
p.L1936P
17.15-Schaaf2011 T
CACNA1C     Schaaf2011:12chr12:
2788667-2788667
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.G5173A
c.G5173A
c.G5167A
c.G5116A
c.G5116A
c.G5149A
c.G5272A
c.G5149A
c.G5206A
c.G5206A
c.G5206A
c.G5200A
c.G5149A
c.G5149A
c.G5149A
c.G5149A
c.G5140A
c.G5149A
c.G5149A
c.G5233A
c.G5209A
c.G5293A
c.G5293A
p.A1725T
p.A1725T
p.A1723T
p.A1706T
p.A1706T
p.A1717T
p.A1758T
p.A1717T
p.A1736T
p.A1736T
p.A1736T
p.A1734T
p.A1717T
p.A1717T
p.A1717T
p.A1717T
p.A1714T
p.A1717T
p.A1717T
p.A1745T
p.A1737T
p.A1765T
p.A1765T
14.382.0E-4Schaaf2011 T
CACNA1C     SP0016315chr12:
2613622-2613622
TGexonicDe novostopgainNM_001129840
NM_001167623
NM_001167624
NM_001167625
c.T1134G
c.T1134G
c.T1134G
c.T1134G
p.Y378X
p.Y378X
p.Y378X
p.Y378X
39.0-Fu2022 E
CACNA1C     Schaaf2011:13chr12:
2788865-2788865
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.G5371A
c.G5371A
c.G5365A
c.G5314A
c.G5314A
c.G5347A
c.G5470A
c.G5347A
c.G5404A
c.G5404A
c.G5404A
c.G5398A
c.G5347A
c.G5347A
c.G5347A
c.G5347A
c.G5338A
c.G5347A
c.G5347A
c.G5431A
c.G5407A
c.G5491A
c.G5491A
p.G1791S
p.G1791S
p.G1789S
p.G1772S
p.G1772S
p.G1783S
p.G1824S
p.G1783S
p.G1802S
p.G1802S
p.G1802S
p.G1800S
p.G1783S
p.G1783S
p.G1783S
p.G1783S
p.G1780S
p.G1783S
p.G1783S
p.G1811S
p.G1803S
p.G1831S
p.G1831S
5.1399.177E-6Schaaf2011 T
CACNA1C     AU2951302chr12:
2207952-2207952
GAintronicDe novo--Yuen2017 G
CACNA1C     SP0065670chr12:
2791834-2791834
TCexonicDe novononsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.T5587C
c.T5587C
c.T5581C
c.T5530C
c.T5563C
c.T5686C
c.T5620C
c.T5620C
c.T5620C
c.T5614C
c.T5563C
c.T5563C
c.T5563C
c.T5563C
c.T5554C
c.T5563C
c.T5743C
c.T5668C
c.T5647C
c.T5623C
c.T5668C
c.T5707C
c.T5812C
p.S1863P
p.S1863P
p.S1861P
p.S1844P
p.S1855P
p.S1896P
p.S1874P
p.S1874P
p.S1874P
p.S1872P
p.S1855P
p.S1855P
p.S1855P
p.S1855P
p.S1852P
p.S1855P
p.S1915P
p.S1890P
p.S1883P
p.S1875P
p.S1890P
p.S1903P
p.S1938P
17.46-Fu2022 E
Trost2022 G
Zhou2022 GE
CACNA1C     Schaaf2011:18chr12:
2797785-2797785
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.G5981A
c.G5981A
c.G5975A
c.G5924A
c.G5957A
c.G6080A
c.G6014A
c.G6014A
c.G6014A
c.G6008A
c.G5957A
c.G5957A
c.G5957A
c.G5957A
c.G5948A
c.G5957A
c.G6137A
c.G6062A
c.G6041A
c.G6017A
c.G6062A
c.G6101A
c.G6206A
p.S1994N
p.S1994N
p.S1992N
p.S1975N
p.S1986N
p.S2027N
p.S2005N
p.S2005N
p.S2005N
p.S2003N
p.S1986N
p.S1986N
p.S1986N
p.S1986N
p.S1983N
p.S1986N
p.S2046N
p.S2021N
p.S2014N
p.S2006N
p.S2021N
p.S2034N
p.S2069N
28.78.334E-6Schaaf2011 T
CACNA1C     Schaaf2011:19chr12:
2797868-2797868
GAexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.G6064A
c.G6064A
c.G6058A
c.G6007A
c.G6040A
c.G6163A
c.G6097A
c.G6097A
c.G6097A
c.G6091A
c.G6040A
c.G6040A
c.G6040A
c.G6040A
c.G6031A
c.G6040A
c.G6220A
c.G6145A
c.G6124A
c.G6100A
c.G6145A
c.G6184A
c.G6289A
p.V2022I
p.V2022I
p.V2020I
p.V2003I
p.V2014I
p.V2055I
p.V2033I
p.V2033I
p.V2033I
p.V2031I
p.V2014I
p.V2014I
p.V2014I
p.V2014I
p.V2011I
p.V2014I
p.V2074I
p.V2049I
p.V2042I
p.V2034I
p.V2049I
p.V2062I
p.V2097I
12.264.0E-4Schaaf2011 T
CACNA1C     Schaaf2011:16chr12:
2794993-2794993
CTexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.C5689T
c.C5689T
c.C5683T
c.C5632T
c.C5665T
c.C5788T
c.C5722T
c.C5722T
c.C5722T
c.C5716T
c.C5665T
c.C5665T
c.C5665T
c.C5665T
c.C5656T
c.C5665T
c.C5845T
c.C5770T
c.C5749T
c.C5725T
c.C5770T
c.C5809T
c.C5914T
p.R1897C
p.R1897C
p.R1895C
p.R1878C
p.R1889C
p.R1930C
p.R1908C
p.R1908C
p.R1908C
p.R1906C
p.R1889C
p.R1889C
p.R1889C
p.R1889C
p.R1886C
p.R1889C
p.R1949C
p.R1924C
p.R1917C
p.R1909C
p.R1924C
p.R1937C
p.R1972C
8.7080.0075Schaaf2011 T
CACNA1C     SP0021412chr12:
2705045-2705045
GAexonicDe novononsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2660A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
c.G2669A
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
p.R887H
p.R890H
p.R890H
p.R890H
p.R890H
p.R890H
29.3-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
CACNA1C     Schaaf2011:17chr12:
2797697-2797697
GCexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.G5893C
c.G5893C
c.G5887C
c.G5836C
c.G5869C
c.G5992C
c.G5926C
c.G5926C
c.G5926C
c.G5920C
c.G5869C
c.G5869C
c.G5869C
c.G5869C
c.G5860C
c.G5869C
c.G6049C
c.G5974C
c.G5953C
c.G5929C
c.G5974C
c.G6013C
c.G6118C
p.A1965P
p.A1965P
p.A1963P
p.A1946P
p.A1957P
p.A1998P
p.A1976P
p.A1976P
p.A1976P
p.A1974P
p.A1957P
p.A1957P
p.A1957P
p.A1957P
p.A1954P
p.A1957P
p.A2017P
p.A1992P
p.A1985P
p.A1977P
p.A1992P
p.A2005P
p.A2040P
16.04-Schaaf2011 T
CACNA1C     1-0526-003chr12:
2172120-2172120
CTintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     Schaaf2011:20chr12:
2797944-2797944
CGexonicUnknownnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.C6140G
c.C6140G
c.C6134G
c.C6083G
c.C6116G
c.C6239G
c.C6173G
c.C6173G
c.C6173G
c.C6167G
c.C6116G
c.C6116G
c.C6116G
c.C6116G
c.C6107G
c.C6116G
c.C6296G
c.C6221G
c.C6200G
c.C6176G
c.C6221G
c.C6260G
c.C6365G
p.A2047G
p.A2047G
p.A2045G
p.A2028G
p.A2039G
p.A2080G
p.A2058G
p.A2058G
p.A2058G
p.A2056G
p.A2039G
p.A2039G
p.A2039G
p.A2039G
p.A2036G
p.A2039G
p.A2099G
p.A2074G
p.A2067G
p.A2059G
p.A2074G
p.A2087G
p.A2122G
32.08.846E-5Schaaf2011 T
CACNA1C     SSC10900chr12:
2717804-2717804
GCexonicDe novononsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3475C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3544C
c.G3544C
c.G3544C
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1159L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1182L
p.V1182L
p.V1182L
29.3-Antaki2022 GE
Chan2022 G
CACNA1C     Lim2017:36081chr12:
2717804-2717804
GCexonicMosaicnonsynonymous SNVNM_000719
NM_001129829
NM_001129830
NM_001129831
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_001129827
NM_001129832
NM_199460
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3475C
c.G3484C
c.G3484C
c.G3484C
c.G3484C
c.G3544C
c.G3544C
c.G3544C
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1159L
p.V1162L
p.V1162L
p.V1162L
p.V1162L
p.V1182L
p.V1182L
p.V1182L
29.3-Lim2017 E
CACNA1C     12795.p1chr12:
2262202-2262202
GAintronicDe novo--Turner2016 G
CACNA1C     7-0256-003chr12:
2350623-2350623
CTintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-1510-003chr12:
2418643-2418681
CCACACACACACACATACACACACACACACACACACACACCACACACACACATACACACACACACACACACACACAintronicDe novo--Yuen2017 G
CACNA1C     MCD-016-3chr12:
2797853-2797853
CTexonicMaternalnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.C6049T
c.C6049T
c.C6043T
c.C5992T
c.C6025T
c.C6148T
c.C6082T
c.C6082T
c.C6082T
c.C6076T
c.C6025T
c.C6025T
c.C6025T
c.C6025T
c.C6016T
c.C6025T
c.C6205T
c.C6130T
c.C6109T
c.C6085T
c.C6130T
c.C6169T
c.C6274T
p.R2017W
p.R2017W
p.R2015W
p.R1998W
p.R2009W
p.R2050W
p.R2028W
p.R2028W
p.R2028W
p.R2026W
p.R2009W
p.R2009W
p.R2009W
p.R2009W
p.R2006W
p.R2009W
p.R2069W
p.R2044W
p.R2037W
p.R2029W
p.R2044W
p.R2057W
p.R2092W
13.01-Tuncay2023 G
CACNA1C     AU4392302chr12:
2284334-2284334
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     2-0145-004chr12:
2561942-2561942
TCintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     1-0459-003chr12:
2337839-2337840
AGAintronicDe novo--Yuen2017 G
CACNA1C     7-0095-003chr12:
2825623-2825623
CAintergenicDe novo--Yuen2017 G
CACNA1C     Alvarez-Mora2016:ASD-21chr12:
2797859-2797859
GAexonicMaternalnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_000719
NM_001129829
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167625
NM_001129830
NM_001129831
NM_001129832
NM_001167624
NM_001129827
NM_199460
c.G6055A
c.G6055A
c.G6049A
c.G5998A
c.G6031A
c.G6154A
c.G6088A
c.G6088A
c.G6088A
c.G6082A
c.G6031A
c.G6031A
c.G6031A
c.G6031A
c.G6022A
c.G6031A
c.G6211A
c.G6136A
c.G6115A
c.G6091A
c.G6136A
c.G6175A
c.G6280A
p.V2019I
p.V2019I
p.V2017I
p.V2000I
p.V2011I
p.V2052I
p.V2030I
p.V2030I
p.V2030I
p.V2028I
p.V2011I
p.V2011I
p.V2011I
p.V2011I
p.V2008I
p.V2011I
p.V2071I
p.V2046I
p.V2039I
p.V2031I
p.V2046I
p.V2059I
p.V2094I
7.1329.824E-6Alvarez-Mora2016 T
CACNA1C     7-0149-003chr12:
2303178-2303178
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     3140_17auchr12:
2224447-2224447
CTexonicDe novononsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
c.C107T
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
p.A36V
13.92.33E-5Fu2022 E
CACNA1C     1-0464-003chr12:
2571127-2571127
AGintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CACNA1C     138chr12:
2789681-2789681
GAexonicPaternalnonsynonymous SNVNM_001167625c.G5564Ap.C1855Y5.1075.0E-4Wen2017 E
CACNA1C     7-0450-003chr12:
2675597-2675597
GAexonicDe novostopgainNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1509A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
c.G1518A
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
p.W503X
p.W506X
p.W506X
p.W506X
p.W506X
p.W506X
35.0-Trost2022 G
Zhou2022 GE
CACNA1C     1-0186-004chr12:
2710653-2710653
GAintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     1-0345-003chr12:
2182797-2182797
AGintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     AU3154302chr12:
2454742-2454742
ACintronicDe novo--Trost2022 G
Yuen2017 G
CACNA1C     Viggiano2022:16.3chr12:
2788680-2788680
CGexonicMaternalnonsynonymous SNVNM_001129837
NM_001129838
NM_001129839
NM_001129846
NM_001167625
NM_000719
NM_001129829
NM_001129830
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001167623
NM_001167624
NM_001129831
NM_001129832
NM_001129827
NM_199460
c.C5186G
c.C5186G
c.C5180G
c.C5129G
c.C5129G
c.C5162G
c.C5285G
c.C5162G
c.C5219G
c.C5219G
c.C5219G
c.C5213G
c.C5162G
c.C5162G
c.C5162G
c.C5162G
c.C5153G
c.C5162G
c.C5162G
c.C5246G
c.C5222G
c.C5306G
c.C5306G
p.T1729S
p.T1729S
p.T1727S
p.T1710S
p.T1710S
p.T1721S
p.T1762S
p.T1721S
p.T1740S
p.T1740S
p.T1740S
p.T1738S
p.T1721S
p.T1721S
p.T1721S
p.T1721S
p.T1718S
p.T1721S
p.T1721S
p.T1749S
p.T1741S
p.T1769S
p.T1769S
15.525.235E-5Viggiano2022 GT
CACNA1C     Viggiano2022:25.3chr12:
2602428-2602428
CTexonicMaternalnonsynonymous SNVNM_000719
NM_001129827
NM_001129829
NM_001129830
NM_001129831
NM_001129832
NM_001129833
NM_001129834
NM_001129835
NM_001129836
NM_001129837
NM_001129838
NM_001129839
NM_001129840
NM_001129841
NM_001129842
NM_001129843
NM_001129844
NM_001129846
NM_001167623
NM_001167624
NM_001167625
NM_199460
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
c.C980T
c.C989T
c.C989T
c.C989T
c.C989T
c.C989T
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
p.T327M
p.T330M
p.T330M
p.T330M
p.T330M
p.T330M
18.832.482E-5Viggiano2022 GT
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More