or
or
Exact

Results for "GCOM1"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GCOM1     1-0373-003chr15:
58014546-58014546
AGintergenicDe novo--Yuen2017 G
GCOM1     SD0708013_33chr15:
57924768-57924768
TCintronicDe novo--Fu2022 E
GCOM1     AU08903chr15:
57913816-57913816
CTexonicDe novononsynonymous SNVNM_001018090
NM_001018091
NM_001018100
NM_001285900
NM_152451
c.C329T
c.C329T
c.C329T
c.C329T
c.C329T
p.T110I
p.T110I
p.T110I
p.T110I
p.T110I
21.2-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
GCOM1     SP0018301chr15:
57896593-57896593
CTintronicDe novo--Fu2022 E
GCOM1     1-0777-003chr15:
58121370-58121370
TCintergenicDe novo--Yuen2017 G
GCOM1     AU4219302chr15:
57906545-57906545
GTintronicDe novo--Yuen2017 G
GCOM1     08C76793chr15:
58004208-58004208
CAexonicDe novononsynonymous SNVNM_001018102
NM_015532
NM_001018090
NM_001285900
c.C314A
c.C785A
c.C1331A
c.C1976A
p.S105Y
p.S262Y
p.S444Y
p.S659Y
14.74-Fu2022 E
Satterstrom2020 E
GCOM1     2-1278-003chr15:
58053461-58053461
GTintergenicDe novo--Yuen2017 G
GCOM1     2-1741-003chr15:
58123090-58123090
AGintergenicDe novo--Yuen2017 G
GCOM1     AU1795301chr15:
58034182-58034182
GCintergenicDe novo--Yuen2017 G
GCOM1     6265chr15:
58001002-58001005
TAGATexonicDe novononframeshift deletionNM_015532
NM_001285900
c.205_207del
c.1396_1398del
p.69_69del
p.466_466del
--Fu2022 E
GCOM1     2-1480-003chr15:
58155285-58155285
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
GCOM1     AU076704chr15:
57937072-57937072
GAintronicDe novo--Yuen2017 G
GCOM1     1-0551-004chr15:
58159801-58159801
GAintergenicDe novo--Yuen2017 G
GCOM1     AU056803chr15:
58032639-58032639
ACintergenicDe novo--Yuen2017 G
GCOM1     13757.p1 Complex Event; expand row to view variants  De novononframeshift deletionNM_015532
NM_001285900
NM_015532
NM_001285900
c.205_207del
c.1396_1398del
c.206_208del
c.1397_1399del
p.69_69del
p.466_466del
p.69_70del
p.466_467del
--Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
O’Roak2014 T
Satterstrom2020 E
Wilfert2021 G
GCOM1     2-0129-004chr15:
58025734-58025734
TCintergenicDe novo--Yuen2017 G
GCOM1     AU000704chr15:
58228655-58228657
ACCACintergenicDe novo--Yuen2017 G
GCOM1     2-1605-003chr15:
58149979-58149979
TCintergenicDe novo--Yuen2017 G
GCOM1     AU4336301chr15:
58196490-58196501
CTCTGTCTGTCTCTCTGTCTintergenicDe novo--Yuen2017 G
GCOM1     SP0014818chr15:
57999278-57999278
CTintronicDe novo--Fu2022 E
GCOM1     5-0040-003chr15:
58178589-58178589
CTintergenicDe novo--Yuen2017 G
GCOM1     AU060403chr15:
58208836-58208836
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More