or
or
Exact

Results for "FAM189A1"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FAM189A1     2-1235-004chr15:
29802484-29802484
ATintronicDe novo--Yuen2017 G
FAM189A1     2-1094-004chr15:
29835357-29835357
GGTTAACTTCTTGCTTTTAATGAGACTGTCTintronicDe novo--Yuen2017 G
FAM189A1     1-0253-005chr15:
29949123-29949123
TCintergenicDe novo--Yuen2017 G
FAM189A1     AU1894304chr15:
29553985-29553985
AGintronicDe novo--Yuen2017 G
FAM189A1     AU3051303chr15:
29571409-29571409
GAintronicDe novo--Yuen2017 G
FAM189A1     1-0346-004chr15:
29850908-29850908
CCTCCTCTintronicDe novo--Yuen2017 G
FAM189A1     AU072005chr15:
29720122-29720122
GAintronicDe novo--Yuen2017 G
FAM189A1     AU015903chr15:
29590857-29590857
TCintronicDe novo--Yuen2017 G
FAM189A1     AU3506303chr15:
29828680-29828681
CGCGGintronicDe novo--Yuen2017 G
FAM189A1     2-1283-003chr15:
29918207-29918207
CAintergenicDe novo--Yuen2017 G
FAM189A1     iHART1383chr15:
29429241-29429241
GAexonicMaternalstopgainNM_015307c.C787Tp.Q263X17.61-Ruzzo2019 G
FAM189A1     PN400273chr15:
29544615-29544615
CTexonicUnknownnonsynonymous SNVNM_015307c.G344Ap.C115Y24.83.0E-4Leblond2019 E
FAM189A1     2-1251-003chr15:
29584472-29584472
TCintronicDe novo--Yuen2017 G
FAM189A1     AU003406chr15:
29454598-29454598
GAintronicDe novo--Yuen2017 G
FAM189A1     1-0153-004chr15:
29850908-29850908
CCTCCTCTintronicDe novo--Yuen2017 G
FAM189A1     AU3051302chr15:
29509861-29509868
CTTCTTGTCTintronicDe novo--Yuen2017 G
FAM189A1     PN400325chr15:
29416952-29416952
GCexonicUnknownstopgainNM_015307c.C1241Gp.S414X17.085.288E-5Leblond2019 E
FAM189A1     PN400285chr15:
29416952-29416952
GCexonicUnknownstopgainNM_015307c.C1241Gp.S414X17.085.288E-5Leblond2019 E
FAM189A1     1-0336-004chr15:
29990480-29990480
GCintergenicDe novo--Yuen2017 G
FAM189A1     PN400488chr15:
29416952-29416952
GCexonicUnknownstopgainNM_015307c.C1241Gp.S414X17.085.288E-5Leblond2019 E
FAM189A1     13946.p1chr15:
29631323-29631323
TGintronicDe novo--Turner2016 G
FAM189A1     AU3343301chr15:
29939567-29939567
GAintergenicDe novo--Yuen2017 G
FAM189A1     2-1314-003chr15:
29526288-29526288
GAintronicDe novo--Yuen2016 G
FAM189A1     2-1507-003chr15:
29831350-29831350
CTintronicDe novo--Yuen2017 G
FAM189A1     14482.p1chr15:
29694528-29694528
AGintronicDe novo--Turner2016 G
FAM189A1     1-0914-003chr15:
29429735-29429735
CTintronicDe novo--Yuen2017 G
FAM189A1     12568.p1chr15:
29967197-29967197
AGintergenicDe novo--Turner2016 G
FAM189A1     2-0210-005chr15:
29722592-29722592
CTintronicDe novo--Yuen2017 G
FAM189A1     2-1184-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
FAM189A1     2-1619-003chr15:
29850914-29850914
TTCCACCintronicDe novo--Yuen2017 G
FAM189A1     AU027506chr15:
29607562-29607562
GAintronicDe novo--Yuen2017 G
FAM189A1     SP0069482chr15:
29862638-29862638
GCintronicDe novo--Fu2022 E
FAM189A1     1-0010-005chr15:
29426906-29426907
CTCintronicDe novo--Yuen2017 G
FAM189A1     2-1266-003chr15:
29718700-29718700
CTintronicDe novo--Yuen2016 G
Yuen2017 G
FAM189A1     1-0595-005chr15:
29705524-29705528
AGATCAintronicDe novo--Yuen2017 G
FAM189A1     2-1093-003chr15:
29982685-29982685
CTintergenicDe novo--Yuen2017 G
FAM189A1     AU4315302chr15:
29832006-29832006
CTintronicDe novo--Yuen2017 G
FAM189A1     AU3724301chr15:
29648460-29648460
AGintronicDe novo--Yuen2017 G
FAM189A1     A27chr15:
29732405-29732405
ACintronicDe novo--Wu2018 G
FAM189A1     AU3451301chr15:
29685514-29685514
CTintronicDe novo--Yuen2017 G
FAM189A1     AU4033304chr15:
29929374-29929374
CTintergenicDe novo--Yuen2017 G
FAM189A1     2-0143-004chr15:
29853195-29853195
TTAintronicDe novo--Yuen2017 G
FAM189A1     AU069603chr15:
29422404-29422404
CTintronicDe novo--Yuen2017 G
FAM189A1     AU4378301chr15:
29901253-29901253
CTintergenicDe novo--Yuen2017 G
FAM189A1     AU3125301chr15:
29926761-29926761
GAintergenicDe novo--Yuen2017 G
FAM189A1     2-1283-004chr15:
29918207-29918207
CAintergenicDe novo--Yuen2017 G
FAM189A1     AU2123301chr15:
29751262-29751262
TCintronicDe novo--Yuen2017 G
FAM189A1     1-0555-003chr15:
29917734-29917734
ACintergenicDe novo--Yuen2017 G
FAM189A1     1-0973-003chr15:
29719850-29719850
CTintronicDe novo--Yuen2017 G
FAM189A1     AU1742302chr15:
29629950-29629950
CTintronicDe novo--Yuen2017 G
FAM189A1     1-0555-003chr15:
29874891-29874899
TGTTGCTCATintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More