or
or
Exact

Results for "FAM120B"

Variant Events: 21

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FAM120B     1-0551-004chr6:
170734974-170734974
AGintergenicDe novo--Yuen2017 G
FAM120B     AU050910chr6:
170708454-170708454
GAintronicDe novo--Yuen2017 G
FAM120B     2-1215-003chr6:
170700344-170700344
CTintronicDe novo--Yuen2017 G
FAM120B     2-1254-003chr6:
170810745-170810745
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
FAM120B     13499.p1chr6:
170627691-170627691
TAexonicDe novononsynonymous SNVNM_001286379
NM_001286380
NM_032448
c.T1249A
c.T1282A
c.T1213A
p.S417T
p.S428T
p.S405T
0.011.787E-5Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
FAM120B     3-0458-000Achr6:
170615391-170615391
CAintronicDe novo--Yuen2017 G
FAM120B     AU2292302chr6:
170708856-170708856
AGintronicDe novo--Yuen2017 G
FAM120B     AU4015302chr6:
170714765-170714765
ACUTR3De novo--Yuen2017 G
FAM120B     10C117939chr6:
170627963-170627963
ACexonicDe novononsynonymous SNVNM_001286379
NM_001286380
NM_032448
c.A1521C
c.A1554C
c.A1485C
p.Q507H
p.Q518H
p.Q495H
10.89-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
FAM120B     3-0428-000chr6:
170728360-170728360
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
FAM120B     2-1244-003chr6:
170804952-170804952
ATintergenicDe novo--Yuen2017 G
FAM120B     7-0024-003chr6:
170761934-170761934
AAGAGTGTGTGAGTAGGAGAGAGGintergenicDe novo--Yuen2017 G
FAM120B     3-0314-000chr6:
170632250-170632250
CGexonicDe novosynonymous SNVNM_001286379
NM_001286380
NM_032448
c.C1854G
c.C1887G
c.C1818G
p.T618T
p.T629T
p.T606T
--Tammimies2015 E
FAM120B     1-0214-003chr6:
170780420-170780420
GAintergenicDe novo--Yuen2017 G
FAM120B     2-1480-003chr6:
170707484-170707484
GAintronicDe novo--Yuen2017 G
FAM120B     2-1720-003chr6:
170798640-170798640
CTintergenicDe novo--Yuen2017 G
FAM120B     AU2525302chr6:
170824537-170824537
CTintergenicDe novo--Yuen2017 G
FAM120B     1-0595-005chr6:
170639119-170639119
AGintronicDe novo--Yuen2017 G
FAM120B     2-1442-003chr6:
170633223-170633223
CTintronicDe novo--Yuen2016 G
Yuen2017 G
FAM120B     3-0458-000Bchr6:
170615391-170615391
CAintronicDe novo--Yuen2017 G
FAM120B     1-0469-003chr6:
170606556-170606556
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More