or
or
Exact

Results for "SPARCL1"

Variant Events: 7

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SPARCL1     2-1196-003chr4:
88505376-88505388
TACACACACACACTACACACACACintergenicDe novo--Yuen2017 G
SPARCL1     2-1299-003chr4:
88469108-88469108
CTintergenicDe novo--Yuen2017 G
SPARCL1     3-0391-000chr4:
88412805-88412805
GAexonicDe novononsynonymous SNVNM_001291977
NM_004684
NM_001128310
NM_001291976
c.C881T
c.C1256T
c.C1256T
c.C881T
p.T294M
p.T419M
p.T419M
p.T294M
10.69-Tammimies2015 E
Yuen2017 G
SPARCL1     2-1127-003chr4:
88528358-88528358
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
SPARCL1     ASDFI_910chr4:
88416183-88416183
CAexonicDe novostopgainNM_004684
NM_001128310
c.G151T
c.G151T
p.E51X
p.E51X
17.77-DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
SPARCL1     1-0233-004chr4:
88524874-88524874
GAintergenicDe novo--Yuen2017 G
SPARCL1     AU3951301chr4:
88473139-88473139
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More