or
or
Exact

Results for "TCF12"

Variant Events: 37

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TCF12     217-14129-2250chr15:
57535733-57535733
CTexonicMaternalnonsynonymous SNVNM_001306220
NM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.C391T
c.C589T
c.C589T
c.C1099T
c.C1099T
c.C1099T
c.C1099T
p.P131S
p.P197S
p.P197S
p.P367S
p.P367S
p.P367S
p.P367S
33.0-Wang2020 T
Wang2020 T
TCF12     JS0068.p1chr15:
57523386-57523386
CTexonicUnknownnonsynonymous SNVNM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.C106T
c.C106T
c.C616T
c.C616T
c.C616T
c.C616T
p.R36C
p.R36C
p.R206C
p.R206C
p.R206C
p.R206C
22.71.648E-5Wang2020 T
Wang2020 T
TCF12     84254374chr15:
57544617-57544617
AGsplicingMaternalsplicing18.31-Wang2020 T
Wang2020 T
Wang2020 T
TCF12     AU2495301chr15:
57355310-57355310
CGintronicDe novo--Yuen2017 G
TCF12     197176chr15:
57523386-57523386
CTexonicUnknownnonsynonymous SNVNM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.C106T
c.C106T
c.C616T
c.C616T
c.C616T
c.C616T
p.R36C
p.R36C
p.R206C
p.R206C
p.R206C
p.R206C
22.71.648E-5Wang2020 T
Wang2020 T
Wang2020 T
TCF12     246793chr15:
57526288-57526288
GCexonicUnknownnonsynonymous SNVNM_001306220
NM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.G310C
c.G508C
c.G508C
c.G1018C
c.G1018C
c.G1018C
c.G1018C
p.G104R
p.G170R
p.G170R
p.G340R
p.G340R
p.G340R
p.G340R
23.0-Wang2020 T
Wang2020 T
Wang2020 T
TCF12     1-0507-003chr15:
57355956-57355957
GAGexonicDe novoframeshift deletionNM_003205
NM_207036
NM_207037
NM_207038
c.158delA
c.158delA
c.158delA
c.158delA
p.E53fs
p.E53fs
p.E53fs
p.E53fs
--Wang2020 T
Yuen2016 G
TCF12     3-0459-000chr15:
57535740-57535740
CCGexonicMaternalframeshift insertionNM_001306220
NM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.398_399insG
c.596_597insG
c.596_597insG
c.1106_1107insG
c.1106_1107insG
c.1106_1107insG
c.1106_1107insG
p.P133fs
p.P199fs
p.P199fs
p.P369fs
p.P369fs
p.P369fs
p.P369fs
--Tammimies2015 E
TCF12     AU3874302chr15:
57245642-57245642
TCintronicDe novo--Yuen2017 G
TCF12     1-0203-004chr15:
57313956-57313956
ATintronicDe novo--Yuen2017 G
TCF12     M23597chr15:
57545653-57545653
GAexonicUnknownnonsynonymous SNVNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.G674A
c.G872A
c.G944A
c.G1382A
c.G1382A
c.G1454A
c.G1454A
p.R225Q
p.R291Q
p.R315Q
p.R461Q
p.R461Q
p.R485Q
p.R485Q
22.31.0E-4Wang2020 T
Wang2020 T
TCF12     3561-08Dchr15:
57545653-57545653
GAexonicUnknownnonsynonymous SNVNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.G674A
c.G872A
c.G944A
c.G1382A
c.G1382A
c.G1454A
c.G1454A
p.R225Q
p.R291Q
p.R315Q
p.R461Q
p.R461Q
p.R485Q
p.R485Q
22.31.0E-4Wang2020 T
TCF12     AU1848302chr15:
57543265-57543265
AGintronicDe novo--Yuen2017 G
TCF12     2-0225-004chr15:
57500254-57500254
CTintronicDe novo--Yuen2017 G
TCF12     2-1116-003chr15:
57263419-57263419
CGintronicDe novo--Yuen2016 G
Yuen2017 G
TCF12     246792chr15:
57526288-57526288
GCexonicUnknownnonsynonymous SNVNM_001306220
NM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.G310C
c.G508C
c.G508C
c.G1018C
c.G1018C
c.G1018C
c.G1018C
p.G104R
p.G170R
p.G170R
p.G340R
p.G340R
p.G340R
p.G340R
23.0-Wang2020 T
Wang2020 T
TCF12     1-0052-003chr15:
57567588-57567588
TTGTGTGTGintronicDe novo--Yuen2017 G
TCF12     1-0382-003chr15:
57574132-57574132
ACintronicDe novo--Yuen2017 G
TCF12     1-0382-003chr15:
57489241-57489241
TCintronicDe novo--Yuen2017 G
TCF12     03C14347chr15:
57565359-57565359
GAexonicDe novononsynonymous SNVNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.G1097A
c.G1295A
c.G1367A
c.G1805A
c.G1805A
c.G1877A
c.G1877A
p.R366Q
p.R432Q
p.R456Q
p.R602Q
p.R602Q
p.R626Q
p.R626Q
36.0-Wang2020 T
Wang2020 T
TCF12     AU3997302chr15:
57580727-57580727
TAUTR3De novo--Yuen2017 G
TCF12     07C65224chr15:
57458629-57458630
CTCexonicDe novoframeshift deletionNM_003205
NM_207036
NM_207037
NM_207038
c.356delT
c.356delT
c.356delT
c.356delT
p.L119fs
p.L119fs
p.L119fs
p.L119fs
--Wang2020 T
Wang2020 T
Wang2020 T
TCF12     1-0541-003chr15:
57565196-57565196
CTintronicDe novo--Yuen2017 G
TCF12     AU4183301chr15:
57512943-57512943
GAintronicDe novo--Yuen2017 G
TCF12     393223chr15:
57524494-57524495
ACAexonicDe novoframeshift deletionNM_001306219
NM_207040
NM_003205
NM_207036
NM_207037
NM_207038
c.182delC
c.182delC
c.692delC
c.692delC
c.692delC
c.692delC
p.T61fs
p.T61fs
p.T231fs
p.T231fs
p.T231fs
p.T231fs
--Wang2020 T
Wang2020 T
TCF12     SF0083863.p1chr15:
57555429-57555430
TCTexonicDe novoframeshift deletionNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.923delC
c.1121delC
c.1193delC
c.1631delC
c.1631delC
c.1703delC
c.1703delC
p.S308fs
p.S374fs
p.S398fs
p.S544fs
p.S544fs
p.S568fs
p.S568fs
--Wang2020 T
TCF12     03C16229chr15:
57565359-57565359
GAexonicUnknown, De novononsynonymous SNVNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.G1097A
c.G1295A
c.G1367A
c.G1805A
c.G1805A
c.G1877A
c.G1877A
p.R366Q
p.R432Q
p.R456Q
p.R602Q
p.R602Q
p.R626Q
p.R626Q
36.0-Wang2020 T
Wang2020 T
Wang2020 T
TCF12     11122.p1chr15:
57526214-57526214
TAintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TCF12     03C23150chr15:
57565290-57565290
GAexonicPaternal, Unknownnonsynonymous SNVNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.G1028A
c.G1226A
c.G1298A
c.G1736A
c.G1736A
c.G1808A
c.G1808A
p.R343Q
p.R409Q
p.R433Q
p.R579Q
p.R579Q
p.R603Q
p.R603Q
36.0-Wang2020 T
Wang2020 T
Wang2020 T
TCF12     AU3760302chr15:
57448713-57448713
TCintronicDe novo--Yuen2017 G
TCF12     HEN0180.p1chr15:
57364892-57364892
CTintronicPaternal37.0-Wang2020 T
Wang2020 T
TCF12     AU048206chr15:
57461916-57461916
TCintronicDe novo--Yuen2017 G
TCF12     7-0135-003chr15:
57307373-57307373
CTintronicDe novo--Yuen2017 G
TCF12     AU4235302chr15:
57279976-57279976
TCintronicDe novo--Yuen2017 G
TCF12     2-1511-003chr15:
57300159-57300190
GTCTCTCTCTCTCTCTCGCTCTCTCTCTCTCTGTCTCTCTCTCTCTCGCTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
TCF12     2-1579-003chr15:
57240081-57240081
ATintronicDe novo--Yuen2017 G
TCF12     03C23149chr15:
57565290-57565290
GAexonicPaternalnonsynonymous SNVNM_001306220
NM_207040
NM_001306219
NM_003205
NM_207038
NM_207036
NM_207037
c.G1028A
c.G1226A
c.G1298A
c.G1736A
c.G1736A
c.G1808A
c.G1808A
p.R343Q
p.R409Q
p.R433Q
p.R579Q
p.R579Q
p.R603Q
p.R603Q
36.0-Wang2020 T
Wang2020 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More