or
or
Exact

Results for "PHKB"

Variant Events: 71

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PHKB     5-0129-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0305-004chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     iHART1810chr16:
47630336-47630336
TAexonicPaternalstopgainNM_000293
NM_001031835
c.T1257A
c.T1236A
p.Y419X
p.Y412X
37.05.777E-5Ruzzo2019 G
PHKB     1-0295-003chr16:
47778346-47778346
CGintergenicDe novo--Yuen2017 G
PHKB     1-0305-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     iHART2111chr16:
47545681-47545681
CTexonicPaternalstopgainNM_000293
NM_001031835
c.C511T
c.C490T
p.Q171X
p.Q164X
21.1-Ruzzo2019 G
PHKB     1-0756-005chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     2-1258-003chr16:
47852391-47852391
TCintergenicDe novo--Yuen2017 G
PHKB     AU2089301chr16:
47669602-47669602
CTintronicDe novo--Yuen2017 G
PHKB     1-0079-008chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-1505-003chr16:
47539127-47539129
CGTCintronicDe novo--Yuen2017 G
PHKB     A31chr16:
47879689-47879689
CTintergenicDe novo--Wu2018 G
PHKB     1-0126-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     AU066104chr16:
47572333-47572333
TGintronicDe novo--Yuen2017 G
PHKB     2-1215-003chr16:
47538719-47538719
AGintronicDe novo--Yuen2017 G
PHKB     1-0065-004chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     SP0018789chr16:
47698814-47698814
GAexonicDe novosynonymous SNVNM_000293c.G2355Ap.G785G--Feliciano2019 E
PHKB     2-1128-003chr16:
47762905-47762905
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
PHKB     1-0395-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-0272-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0169-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     AU4079302chr16:
47735241-47735241
CTUTR3De novo--Yuen2017 G
PHKB     AU1933302chr16:
47647079-47647079
CGintronicDe novo--Yuen2017 G
PHKB     1-0625-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0683-004chr16:
47538775-47538775
TCintronicDe novo--Yuen2017 G
PHKB     2-1089-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0144-005chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0126-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-1440-003chr16:
47552181-47552195
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
PHKB     11216.p1chr16:
47699978-47699978
CTintronicDe novo--Satterstrom2020 E
PHKB     1-0625-003chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     AU3809302chr16:
47792719-47792719
TGintergenicDe novo--Yuen2017 G
PHKB     1-0139-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-1174-005Bchr16:
47539127-47539129
CGTCintronicDe novo--Yuen2017 G
PHKB     2-1176-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-0242-005chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-0135-003chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     1-0006-003chr16:
47748290-47748290
AGintergenicDe novo--Yuen2017 G
PHKB     1-0049-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0218-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     AU018010chr16:
47576070-47576070
GAintronicDe novo--Yuen2017 G
PHKB     1-0406-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0139-005chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     12189.p1chr16:
47495300-47495300
GAexonicMosaicstopgainNM_000293c.G39Ap.W13X37.00.0025Dou2017 E
PHKB     2-1275-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0395-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     5-0033-004chr16:
47538719-47538719
AGintronicDe novo--Yuen2017 G
PHKB     5-0033-004chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     2-1619-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-1306-004chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     2-1174-006chr16:
47539127-47539129
CGTCintronicDe novo--Yuen2017 G
PHKB     2-0145-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-1567-004chr16:
47538924-47538924
AGintronicDe novo--Yuen2017 G
PHKB     2-1620-004chr16:
47875184-47875184
TCintergenicDe novo--Yuen2017 G
PHKB     2-0242-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0261-003chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     2-1505-004chr16:
47539127-47539129
CGTCintronicDe novo--Yuen2017 G
PHKB     1-0862-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-0127-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0299-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     3-0227-000chr16:
47614206-47614206
CGexonicDe novononsynonymous SNVNM_000293
NM_001031835
c.C711G
c.C690G
p.S237R
p.S230R
14.05-Tammimies2015 E
PHKB     2-0272-004chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     AU076808chr16:
47862921-47862921
AGintergenicDe novo--Yuen2017 G
PHKB     1-0052-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     5-0003-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     1-0054-004chr16:
47539121-47539121
TCintronicDe novo--Yuen2017 G
PHKB     5-0026-003chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     1-0180-004chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
PHKB     7-0082-003chr16:
47538767-47538767
TCintronicDe novo--Yuen2017 G
PHKB     2-1416-004chr16:
47539270-47539270
CTintronicDe novo--Yuen2017 G
PHKB     1-0534-004chr16:
47539094-47539094
CAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More