or
or
Exact

Results for "MAST4"

Variant Events: 43

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MAST4     421-09-112171chr5:
65892861-65892862
AGAintronicDe novo--Satterstrom2020 E
MAST4     5-0026-003chr5:
66471813-66471813
TCintergenicDe novo--Yuen2017 G
MAST4     14690.p1chr5:
66462054-66462054
AGexonicDe novosynonymous SNVNM_001290227
NM_001297651
NM_001290226
NM_015183
NM_001164664
c.A6264G
c.A6465G
c.A6429G
c.A6480G
c.A7047G
p.T2088T
p.T2155T
p.T2143T
p.T2160T
p.T2349T
4.84-Krumm2015 E
MAST4     1-0912-003chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     2-0081-003chr5:
66208708-66208708
AGintronicDe novo--Yuen2017 G
MAST4     AU3852301chr5:
66012329-66012329
GAintronicDe novo--Yuen2017 G
MAST4     1-0252-003chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     1-0565-004chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     2-1107-003chr5:
66092361-66092361
CGintronicDe novo--Yuen2016 G
Yuen2017 G
MAST4     2-0135-003chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     2-1729-003chr5:
66258078-66258078
GAintronicDe novo--Yuen2017 G
MAST4     AU2123301chr5:
66292491-66292491
TGintronicDe novo--Yuen2017 G
MAST4     3-0169-000chr5:
66131481-66131481
CTintronicDe novo--Yuen2016 G
MAST4     3-0018-000chr5:
66420248-66420263
GTCTCTCTCTCTCTCTGTCTCTCTCTCTCTintronicDe novo--Yuen2017 G
MAST4     AU047704chr5:
66378704-66378704
CGintronicDe novo--Yuen2017 G
MAST4     AU047704chr5:
66420746-66420746
CGintronicDe novo--Yuen2017 G
MAST4     1-0289-004chr5:
66344656-66344656
CTintronicDe novo--Yuen2017 G
MAST4     3-0163-000chr5:
66400357-66400357
GCexonicDe novononsynonymous SNVNM_001297651
NM_001290226
NM_001290227
NM_015183
NM_001164664
c.G728C
c.G692C
c.G728C
c.G743C
c.G1310C
p.R243P
p.R231P
p.R243P
p.R248P
p.R437P
25.02.536E-5Tammimies2015 E
MAST4     AU047704chr5:
66360279-66360279
AGintronicDe novo--Yuen2017 G
MAST4     AU4033304chr5:
66153824-66153824
AGintronicDe novo--Yuen2017 G
MAST4     5-0064-003chr5:
66201952-66201952
AGintronicDe novo--Yuen2017 G
MAST4     2-1210-003chr5:
66458527-66458527
CTexonicDe novononsynonymous SNVNM_001290227
NM_001297651
NM_001290226
NM_015183
NM_001164664
c.C3095T
c.C3296T
c.C3260T
c.C3311T
c.C3878T
p.S1032L
p.S1099L
p.S1087L
p.S1104L
p.S1293L
31.08.283E-6Yuen2017 G
MAST4     1-0489-003chr5:
66077100-66077100
CAintronicDe novo--Yuen2016 G
Yuen2017 G
MAST4     1-0153-005chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     2-0132-004chr5:
66220283-66220283
GGCGATintronicDe novo--Yuen2017 G
MAST4     2-1155-003chr5:
66048172-66048172
AGintronicDe novo--Yuen2017 G
MAST4     2-1456-004chr5:
66357619-66357619
TTTTTCCintronicDe novo--Yuen2017 G
MAST4     2-1409-003chr5:
66425013-66425013
GCintronicDe novo--Yuen2016 G
Yuen2017 G
MAST4     2-1429-004chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     1-0565-003chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     2-0135-004chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     1-0285-004chr5:
66012885-66012885
AGintronicDe novo--Yuen2017 G
MAST4     5-0137-003chr5:
66113998-66113998
CTintronicDe novo--Yuen2017 G
MAST4     1-0524-003chr5:
66286282-66286282
TCintronicDe novo--Yuen2016 G
Yuen2017 G
MAST4     1-0467-005chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     AU2333302chr5:
66229696-66229696
AGintronicDe novo--Yuen2017 G
MAST4     1-0394-003chr5:
66436279-66436279
GAintronicDe novo--Yuen2017 G
MAST4     1-0153-004chr5:
66071503-66071503
CCAATGGTTCTTAAAintronicDe novo--Yuen2017 G
MAST4     AU0146301chr5:
66192017-66192017
AGintronicDe novo--Yuen2017 G
MAST4     AU0146301chr5:
66207194-66207194
TCintronicDe novo--Yuen2017 G
MAST4     7-0183-003chr5:
66382512-66382512
AGintronicDe novo--Yuen2017 G
MAST4     2-1066-003chr5:
66446269-66446269
TCintronicDe novo--Yuen2017 G
MAST4     2-1511-003chr5:
66146339-66146339
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More