or
or
Exact

Results for "CEP350"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CEP350     130091chr1:
180049759-180049759
TCexonicDe novosynonymous SNVNM_014810c.T6087Cp.Y2029Y5.0211.647E-5Fu2022 E
CEP350     AU3051302chr1:
179953715-179953715
TCintronicDe novo--Yuen2017 G
CEP350     4892chr1:
179983048-179983048
ACexonicDe novononsynonymous SNVNM_014810c.A1460Cp.N487T8.7-Fu2022 E
CEP350     2-1296-003chr1:
180019481-180019481
ATintronicDe novo--Yuen2017 G
CEP350     AU4033305chr1:
180029981-180029981
AGintronicDe novo--Yuen2017 G
CEP350     SP0016641chr1:
179983060-179983060
CTexonicDe novononsynonymous SNVNM_014810c.C1472Tp.S491L26.18.281E-6Fu2022 E
CEP350     7-0249-004chr1:
180093095-180093114
GTTCATTCATTCATTCATTCGTTCATTCATTCATTCintergenicDe novo--Yuen2017 G
CEP350     SP0113929chr1:
180056773-180056773
CTexonicDe novononsynonymous SNVNM_014810c.C6346Tp.P2116S22.83.734E-5Fu2022 E
CEP350     AU242Achr1:
179985050-179985050
AGexonicDe novononsynonymous SNVNM_014810c.A2119Gp.S707G27.3-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CEP350     DEASD_2055_001chr1:
180000456-180000456
GTexonicDe novononsynonymous SNVNM_014810c.G3552Tp.W1184C17.53-Fu2022 E
CEP350     AU2117302chr1:
180031520-180031520
TCintronicDe novo--Yuen2017 G
CEP350     3-0111-000chr1:
180083605-180083605
TGUTR3De novo--Yuen2016 G
CEP350     2-0135-004chr1:
179985050-179985050
AGexonicDe novononsynonymous SNVNM_014810c.A2119Gp.S707G27.3-Yuen2017 G
CEP350     3-0111-000chr1:
180083588-180083588
AGUTR3De novo--Yuen2016 G
CEP350     SP0017187chr1:
179924336-179924336
TGintronicDe novo--Fu2022 E
CEP350     1-0912-003chr1:
180027733-180027733
TAintronicDe novo--Yuen2017 G
CEP350     AU2975302chr1:
179950237-179950237
CTintronicDe novo--Yuen2017 G
CEP350     11055.p1chr1:
179983048-179983048
ACexonicDe novononsynonymous SNVNM_014810c.A1460Cp.N487T8.7-Iossifov2014 E
Kosmicki2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
CEP350     1-0323-003chr1:
180045416-180045416
TGintronicDe novo--Yuen2017 G
CEP350     Lim2017:4892chr1:
179983048-179983048
ACexonicDe novononsynonymous SNVNM_014810c.A1460Cp.N487T8.7-Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More