or
or
Exact

Results for "TANC2"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TANC2     7-0078-003chr17:
61488830-61488830
TCintronicDe novo--Yuen2017 G
TANC2     G01-GEA-97-HIchr17:
61497899-61497899
CTexonicDe novononsynonymous SNVNM_025185c.C4556Tp.P1519L17.67-Lim2017 E
Satterstrom2020 E
TANC2     1-0384-003chr17:
61381503-61381503
GAintronicDe novo--Yuen2017 G
TANC2     2-0704-003chr17:
61437885-61437899
CATATATATATATATCATATATATATATintronicDe novo--Yuen2017 G
TANC2     SSC08165chr17:
61498409-61498409
AGexonicDe novononsynonymous SNVNM_025185c.A5066Gp.H1689R10.2-Lim2017 E
TANC2     2-1120-003chr17:
61364590-61364590
GAintronicDe novo--Yuen2017 G
TANC2     5-0106-003chr17:
61488720-61488720
AGintronicDe novo--Yuen2017 G
TANC2     5-0077-003chr17:
61351748-61351754
ATAGAAGAintronicDe novo--Yuen2017 G
TANC2     13573.p1chr17:
61498409-61498409
AGexonicDe novononsynonymous SNVNM_025185c.A5066Gp.H1689R10.2-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
TANC2     7-0223-003chr17:
61284066-61284066
CTintronicDe novo--Yuen2017 G
TANC2     Mahjani2021:120chr17:
61498858-61498858
CTexonicstopgainNM_025185c.C5515Tp.R1839X43.0-Mahjani2021 E
TANC2     14136.p1chr17:
61482569-61482569
CTexonicDe novostopgainNM_025185c.C3196Tp.R1066X41.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
TANC2     14436.p1chr17:
61278319-61278319
GAsplicingMosaic Pat.splicing26.8-Dou2017 E
TANC2     M23654chr17:
61497390-61497390
CTexonicInheritedsynonymous SNVNM_025185c.C4047Tp.N1349N-4.469E-5Stessman2017 T
TANC2     AU3702307chr17:
61348478-61348478
GAintronicDe novo--Yuen2017 G
TANC2     03C21418chr17:
61473156-61473156
GAexonicDe novononsynonymous SNVNM_025185c.G2882Ap.R961Q36.03.568E-5Stessman2017 T
TANC2     AU4056301chr17:
61462248-61462248
AGintronicDe novo--Yuen2017 G
TANC2     2-1180-003chr17:
61424151-61424151
GCintronicDe novo--Yuen2016 G
Yuen2017 G
TANC2     2-1245-003chr17:
61364606-61364606
TCintronicDe novo--Yuen2017 G
TANC2     2-1592-003chr17:
61496205-61496205
GAintronicDe novo--Yuen2017 G
TANC2     1675002chr17:
61391756-61391757
TGTexonicDe novoframeshift deletionNM_025185c.946delGp.A316fs--Satterstrom2020 E
TANC2     AU017304chr17:
61382219-61382219
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More