or
or
Exact

Results for "CNKSR2"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CNKSR2     74-0355chrX:
21551140-21551140
TCintronicDe novo--Michaelson2012 G
CNKSR2     AU2437302chrX:
21547337-21547337
TGintronicDe novo--Yuen2017 G
CNKSR2     S7J3DchrX:
21444725-21444725
CTexonicUnknownnonsynonymous SNVNM_001168647
NM_001168648
NM_001168649
NM_014927
c.C175T
c.C175T
c.C175T
c.C175T
p.R59C
p.R59C
p.R59C
p.R59C
21.6-Wang2020 T
Wang2020 T
CNKSR2     12493.p1chrX:
21467450-21467450
GAintronicDe novo--Turner2016 G
CNKSR2     2-1325-003chrX:
21584443-21584443
AGintronicDe novo--Yuen2017 G
CNKSR2     2-0320-003chrX:
21609056-21609056
ACintronicDe novo--Yuen2017 G
CNKSR2     420862chrX:
21450755-21450756
TATexonicUnknownframeshift deletionNM_001168647
NM_001168648
NM_001168649
NM_014927
c.255delA
c.255delA
c.255delA
c.255delA
p.L85fs
p.L85fs
p.L85fs
p.L85fs
--Wang2020 T
Wang2020 T
CNKSR2     Mahjani2021:124chrX:
21550164-21550164
CTexonicstopgainNM_001168649
NM_001168647
NM_001168648
NM_014927
c.C1135T
c.C1282T
c.C1282T
c.C1282T
p.R379X
p.R428X
p.R428X
p.R428X
37.0-Mahjani2021 E
CNKSR2     13661.p1chrX:
21619398-21619398
ACsplicingDe novosplicing17.92-Wilfert2021 G
CNKSR2     7-0249-003chrX:
21654917-21654931
GTATATATATATATAGTATATATATATATATAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More