or
or
Exact

Results for "ADARB2"

Variant Events: 51

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADARB2     5-0109-003chr10:
1515145-1515145
AGintronicDe novo--Yuen2017 G
ADARB2     2-0006-003chr10:
1923637-1923637
GCintergenicDe novo--Yuen2017 G
ADARB2     2-1357-003chr10:
1275618-1275618
AACGTTintronicDe novo--Yuen2017 G
ADARB2     1-0051-004chr10:
1759747-1759747
CAintronicDe novo--Yuen2017 G
ADARB2     2-1315-003chr10:
1901883-1901883
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ADARB2     1-0197-003chr10:
1568115-1568117
CGTCintronicDe novo--Yuen2017 G
ADARB2     PN400305chr10:
1284303-1284303
CTexonicUnknownnonsynonymous SNVNM_018702c.G1252Ap.G418S36.00.0077Leblond2019 E
ADARB2     2-0070-003chr10:
1395204-1395204
ATintronicDe novo--Yuen2017 G
ADARB2     2-1352-003chr10:
1678487-1678487
GAintronicDe novo--Yuen2016 G
Yuen2017 G
ADARB2     AU3725302chr10:
1333608-1333608
GTintronicDe novo--Yuen2017 G
ADARB2     2-1176-003chr10:
1628545-1628545
AAGTGCTTintronicDe novo--Yuen2017 G
ADARB2     1-0389-004chr10:
1696571-1696571
GAintronicDe novo--Yuen2017 G
ADARB2     PN400512chr10:
1284303-1284303
CTexonicUnknownnonsynonymous SNVNM_018702c.G1252Ap.G418S36.00.0077Leblond2019 E
ADARB2     7-0078-003chr10:
2040608-2040608
TGintergenicDe novo--Yuen2017 G
ADARB2     AU3057301chr10:
1508531-1508531
GAintronicDe novo--Yuen2017 G
ADARB2     2-1619-003chr10:
1917854-1917854
ACintergenicDe novo--Yuen2017 G
ADARB2     2-0122-004chr10:
1668403-1668403
CTintronicDe novo--Yuen2017 G
ADARB2     2-1364-003chr10:
1924748-1924748
CTintergenicDe novo--Yuen2017 G
ADARB2     SP0005166chr10:
1246095-1246095
GTintronicDe novo3.591-Feliciano2019 E
Fu2022 E
ADARB2     AU4173301chr10:
1381502-1381502
GCintronicDe novo--Yuen2017 G
ADARB2     1-0638-003chr10:
1653340-1653340
CTintronicDe novo--Yuen2017 G
ADARB2     EGAN00001101020chr10:
1233756-1233756
TGintronicDe novo--Satterstrom2020 E
ADARB2     2-0285-003chr10:
1275598-1275598
GGTGTGTAintronicDe novo--Yuen2017 G
ADARB2     2-1363-003chr10:
2005956-2005956
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
ADARB2     1-0571-003chr10:
2043203-2043203
AGintergenicDe novo--Yuen2017 G
ADARB2     2-1299-003chr10:
1650584-1650584
GCintronicDe novo--Yuen2017 G
ADARB2     AU076808chr10:
1888048-1888048
ACintergenicDe novo--Yuen2017 G
ADARB2     PN400441chr10:
1284303-1284303
CTexonicUnknownnonsynonymous SNVNM_018702c.G1252Ap.G418S36.00.0077Leblond2019 E
ADARB2     2-1429-003chr10:
1519049-1519049
CGintronicDe novo--Yuen2017 G
ADARB2     AU3727303chr10:
1266183-1266197
ATGGTGGTGGTGGTGATGGTGGTGGTGintronicDe novo--Yuen2017 G
ADARB2     1-0338-005chr10:
1671192-1671192
AGintronicDe novo--Yuen2017 G
ADARB2     1-0994-003chr10:
1372887-1372887
CTintronicDe novo--Yuen2017 G
ADARB2     1-0044-003chr10:
1465090-1465090
ATintronicDe novo--Yuen2017 G
ADARB2     74-0765chr10:
1405594-1405594
GAexonicInheritednonsynonymous SNVNM_018702c.C706Tp.L236F0.0080.0026Patowary2019 E
ADARB2     2-0122-003chr10:
1619891-1619891
GAintronicDe novo--Yuen2017 G
ADARB2     1-0253-005chr10:
1736518-1736518
GAintronicDe novo--Yuen2017 G
ADARB2     AU1987304chr10:
1393301-1393301
CTintronicDe novo--Yuen2017 G
ADARB2     AU046703chr10:
1744758-1744758
GCintronicDe novo--Yuen2017 G
ADARB2     1-0246-005chr10:
1275618-1275618
AACGTTintronicDe novo--Yuen2017 G
ADARB2     2-0171-003chr10:
1252479-1252479
GAintronicDe novo--Yuen2017 G
ADARB2     2-0210-004chr10:
1628886-1628886
AGintronicDe novo--Yuen2017 G
ADARB2     2-0210-004chr10:
1278687-1278694
TGTATGTGTintronicDe novo--Yuen2017 G
ADARB2     AU079605chr10:
1302869-1302869
GAintronicDe novo--Yuen2017 G
ADARB2     1-0148-005chr10:
1829153-1829153
GCintergenicDe novo--Yuen2017 G
ADARB2     1-0972-003chr10:
1442362-1442362
CTintronicDe novo--Yuen2017 G
ADARB2     1-0338-003chr10:
1671192-1671192
AGintronicDe novo--Yuen2017 G
ADARB2     1-0324-003chr10:
1498362-1498362
CTintronicDe novo--Yuen2017 G
ADARB2     2-1497-003chr10:
1520327-1520327
AGintronicDe novo--Yuen2017 G
ADARB2     5-0123-003chr10:
1497004-1497004
CGintronicDe novo--Yuen2017 G
ADARB2     AU3761301chr10:
1890046-1890046
GTintergenicDe novo--Yuen2017 G
ADARB2     2-1085-003chr10:
1370155-1370155
CCAGCTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More