or
or
Exact

Results for "FAT4"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FAT4     Cukier2014:7713chr4:
126373570-126373570
CTexonicUnknownnonsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.C11405T
c.C11405T
c.C11399T
p.S3802F
p.S3802F
p.S3800F
17.630.0373Cukier2014 E
FAT4     1-0261-004chr4:
126263525-126263525
ATintronicDe novo--Yuen2017 G
FAT4     AU2437302chr4:
126272481-126272481
CTintronicDe novo--Yuen2017 G
FAT4     AU3900301chr4:
126244573-126244573
CTintronicDe novo--Yuen2017 G
FAT4     iHART1762chr4:
126336059-126336059
TCexonicDe novononsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.T5941C
c.T5941C
c.T5941C
p.Y1981H
p.Y1981H
p.Y1981H
19.7-Ruzzo2019 G
FAT4     5-0129-003chr4:
126371584-126371584
CAexonicDe novononsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.C9419A
c.C9419A
c.C9413A
p.A3140E
p.A3140E
p.A3138E
12.21-Yuen2017 G
FAT4     05HI3916Achr4:
126389771-126389771
TCexonicDe novononsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.T12010C
c.T12010C
c.T12004C
p.F4004L
p.F4004L
p.F4002L
28.9-Satterstrom2020 E
FAT4     12275.p1chr4:
126238145-126238145
GAexonicDe novosynonymous SNVNM_001291285
NM_001291303
NM_024582
c.G579A
c.G579A
c.G579A
p.P193P
p.P193P
p.P193P
--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
FAT4     AU058104chr4:
126347944-126347944
ACintronicDe novo--Yuen2017 G
FAT4     AU3951301chr4:
126256162-126256162
TCintronicDe novo--Yuen2017 G
FAT4     ASDFI_986chr4:
126240148-126240148
TAexonicDe novononsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.T2582A
c.T2582A
c.T2582A
p.F861Y
p.F861Y
p.F861Y
8.068-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
FAT4     09C83023chr4:
126336650-126336650
GAexonicDe novononsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.G6532A
c.G6532A
c.G6532A
p.A2178T
p.A2178T
p.A2178T
15.821.0E-4DeRubeis2014 E
Kosmicki2017 E
Satterstrom2020 E
FAT4     1-0206-003chr4:
126344437-126344437
GGAAGTCCTGGATGGACTTCCCATCATintronicDe novo--Yuen2017 G
FAT4     09C81416chr4:
126411350-126411350
CTexonicDe novononsynonymous SNVNM_001291285
NM_001291303
NM_024582
c.C13376T
c.C13379T
c.C13373T
p.T4459M
p.T4460M
p.T4458M
8.2478.239E-6DeRubeis2014 E
Kosmicki2017 E
FAT4     2-1381-003chr4:
126414815-126414815
CTdownstreamDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More